EMAIL THIS PAGE TO A FRIEND

FLJ41327

12 Gene Product Result for
Species: Human FLJ41327(401045)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041567 Rosetta Predictions human pricing
XR_041568 Rosetta Predictions human pricing
XR_041569 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528441 predicted 100
2 SASI_Hs02_00528442 predicted 33
3 SASI_Hs02_00528443 predicted 110
4 SASI_Hs02_00528444 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528445 predicted 96
2 SASI_Hs02_00528446 predicted 34
3 SASI_Hs02_00528447 predicted 108
4 SASI_Hs02_00528448 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528449 predicted 93
2 SASI_Hs02_00528450 predicted 33
3 SASI_Hs02_00528451 predicted 108
4 SASI_Hs02_00528452 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207485
FLJ41327 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1986s1c1
Sequence:CCGGCAAACGCCCATGATACTGTGACTCGAGTCACAGTATCATGGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2246s1c1
Sequence:CCGGCCAAAGAGAATGAAACACAAACTCGAGTTTGTGTTTCATTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2050s1c1
Sequence:CCGGCAACATTTATCACAGGCCTAACTCGAGTTAGGCCTGTGATAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2321s1c1
Sequence:CCGGGCAGGATATGTGAAGAACCATCTCGAGATGGTTCTTCACATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2062s1c1
Sequence:CCGGCAGGCCTAAATGGAGAACATACTCGAGTATGTTCTCCATTTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1917s1c1
Sequence:CCGGGAGACGGAGAAAGGTATGACACTCGAGTGTCATACCTTTCTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1727s1c1
Sequence:CCGGGATACCGTGAGAGATGGAGAACTCGAGTTCTCCATCTCTCACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1823s1c1
Sequence:CCGGGTGAGAGACGGAGAAAGGTATCTCGAGATACCTTTCTCCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1732s1c1
Sequence:CCGGCGTGAGAGATGGAGAAAGGTACTCGAGTACCTTTCTCCATCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1817s1c1
Sequence:CCGGGATACTGTGAGAGACGGAGAACTCGAGTTCTCCGTCTCTCACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1923s1c1
Sequence:CCGGGAGAAAGGTATGACAGGAGGACTCGAGTCCTCCTGTCATACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207485
FLJ41327 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1986s1c1
Sequence:CCGGCAAACGCCCATGATACTGTGACTCGAGTCACAGTATCATGGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2246s1c1
Sequence:CCGGCCAAAGAGAATGAAACACAAACTCGAGTTTGTGTTTCATTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2050s1c1
Sequence:CCGGCAACATTTATCACAGGCCTAACTCGAGTTAGGCCTGTGATAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2321s1c1
Sequence:CCGGGCAGGATATGTGAAGAACCATCTCGAGATGGTTCTTCACATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2062s1c1
Sequence:CCGGCAGGCCTAAATGGAGAACATACTCGAGTATGTTCTCCATTTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1917s1c1
Sequence:CCGGGAGACGGAGAAAGGTATGACACTCGAGTGTCATACCTTTCTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1727s1c1
Sequence:CCGGGATACCGTGAGAGATGGAGAACTCGAGTTCTCCATCTCTCACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1823s1c1
Sequence:CCGGGTGAGAGACGGAGAAAGGTATCTCGAGATACCTTTCTCCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1732s1c1
Sequence:CCGGCGTGAGAGATGGAGAAAGGTACTCGAGTACCTTTCTCCATCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1817s1c1
Sequence:CCGGGATACTGTGAGAGACGGAGAACTCGAGTTCTCCGTCTCTCACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1923s1c1
Sequence:CCGGGAGAAAGGTATGACAGGAGGACTCGAGTCCTCCTGTCATACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207485
FLJ41327 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1986s1c1
Sequence:CCGGCAAACGCCCATGATACTGTGACTCGAGTCACAGTATCATGGGCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2246s1c1
Sequence:CCGGCCAAAGAGAATGAAACACAAACTCGAGTTTGTGTTTCATTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2050s1c1
Sequence:CCGGCAACATTTATCACAGGCCTAACTCGAGTTAGGCCTGTGATAAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207485.1-2321s1c1
Sequence:CCGGGCAGGATATGTGAAGAACCATCTCGAGATGGTTCTTCACATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-2062s1c1
Sequence:CCGGCAGGCCTAAATGGAGAACATACTCGAGTATGTTCTCCATTTAGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1917s1c1
Sequence:CCGGGAGACGGAGAAAGGTATGACACTCGAGTGTCATACCTTTCTCCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1727s1c1
Sequence:CCGGGATACCGTGAGAGATGGAGAACTCGAGTTCTCCATCTCTCACGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1823s1c1
Sequence:CCGGGTGAGAGACGGAGAAAGGTATCTCGAGATACCTTTCTCCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1732s1c1
Sequence:CCGGCGTGAGAGATGGAGAAAGGTACTCGAGTACCTTTCTCCATCTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1817s1c1
Sequence:CCGGGATACTGTGAGAGACGGAGAACTCGAGTTCTCCGTCTCTCACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207485.1-1923s1c1
Sequence:CCGGGAGAAAGGTATGACAGGAGGACTCGAGTCCTCCTGTCATACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks