EMAIL THIS PAGE TO A FRIEND

FLJ41423

40 Gene Product Result for
Species: Human FLJ41423(399886)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001679 Rosetta Predictions human pricing
XR_040384 Rosetta Predictions human pricing
XR_040385 Rosetta Predictions human pricing
XR_040386 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124736 predicted 328
2 SASI_Hs01_00124737 predicted 200
3 SASI_Hs01_00124738 predicted 198
4 SASI_Hs01_00124739 predicted 207
5 SASI_Hs01_00124740 predicted 342
6 SASI_Hs01_00124741 predicted 675
7 SASI_Hs01_00124742 predicted 792
8 SASI_Hs01_00124743 predicted 783
9 SASI_Hs01_00124744 predicted 184
10 SASI_Hs01_00124745 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518381 predicted 254
2 SASI_Hs02_00518382 predicted 257
3 SASI_Hs02_00518383 predicted 427
4 SASI_Hs02_00518384 predicted 423
5 SASI_Hs02_00518385 predicted 44
6 SASI_Hs02_00518386 predicted 342
7 SASI_Hs02_00518387 predicted 130
8 SASI_Hs02_00518388 predicted 133
9 SASI_Hs02_00518389 predicted 343
10 SASI_Hs02_00518390 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518391 predicted 257
2 SASI_Hs02_00518392 predicted 264
3 SASI_Hs02_00518393 predicted 421
4 SASI_Hs02_00518394 predicted 420
5 SASI_Hs02_00518395 predicted 36
6 SASI_Hs02_00518396 predicted 349
7 SASI_Hs02_00518397 predicted 125
8 SASI_Hs02_00518398 predicted 136
9 SASI_Hs02_00518399 predicted 346
10 SASI_Hs02_00518400 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518401 predicted 252
2 SASI_Hs02_00518402 predicted 265
3 SASI_Hs02_00518403 predicted 429
4 SASI_Hs02_00518404 predicted 422
5 SASI_Hs02_00518405 predicted 42
6 SASI_Hs02_00518406 predicted 342
7 SASI_Hs02_00518407 predicted 130
8 SASI_Hs02_00518408 predicted 128
9 SASI_Hs02_00518409 predicted 342
10 SASI_Hs02_00518410 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378288
FLJ41423 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2003s1c1
Sequence:CCGGGAGCCAAGATTTCCCAGATCACTCGAGTGATCTGGGAAATCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2033s1c1
Sequence:CCGGCAAGATAAGCACAGCTTTCTACTCGAGTAGAAAGCTGTGCTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2019s1c1
Sequence:CCGGGATCAGCCTACAGCCAAGATACTCGAGTATCTTGGCTGTAGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2082s1c1
Sequence:CCGGGAAGAATCACTCAGCCATCCTCTCGAGAGGATGGCTGAGTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2085s1c1
Sequence:CCGGGAATCACTCAGCCATCCTGTACTCGAGTACAGGATGGCTGAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378288.1-2093s1c1
Sequence:CCGGCAGCCATCCTGTATATTGTAGCTCGAGCTACAATATACAGGATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378288
FLJ41423 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2003s1c1
Sequence:CCGGGAGCCAAGATTTCCCAGATCACTCGAGTGATCTGGGAAATCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2033s1c1
Sequence:CCGGCAAGATAAGCACAGCTTTCTACTCGAGTAGAAAGCTGTGCTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2019s1c1
Sequence:CCGGGATCAGCCTACAGCCAAGATACTCGAGTATCTTGGCTGTAGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2082s1c1
Sequence:CCGGGAAGAATCACTCAGCCATCCTCTCGAGAGGATGGCTGAGTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2085s1c1
Sequence:CCGGGAATCACTCAGCCATCCTGTACTCGAGTACAGGATGGCTGAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378288.1-2093s1c1
Sequence:CCGGCAGCCATCCTGTATATTGTAGCTCGAGCTACAATATACAGGATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378288
FLJ41423 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2003s1c1
Sequence:CCGGGAGCCAAGATTTCCCAGATCACTCGAGTGATCTGGGAAATCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2033s1c1
Sequence:CCGGCAAGATAAGCACAGCTTTCTACTCGAGTAGAAAGCTGTGCTTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2019s1c1
Sequence:CCGGGATCAGCCTACAGCCAAGATACTCGAGTATCTTGGCTGTAGGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2082s1c1
Sequence:CCGGGAAGAATCACTCAGCCATCCTCTCGAGAGGATGGCTGAGTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378288.1-2085s1c1
Sequence:CCGGGAATCACTCAGCCATCCTGTACTCGAGTACAGGATGGCTGAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378288.1-2093s1c1
Sequence:CCGGCAGCCATCCTGTATATTGTAGCTCGAGCTACAATATACAGGATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks