EMAIL THIS PAGE TO A FRIEND

FLJ41733

40 Gene Product Result for
Species: Human FLJ41733(400870)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207473 Rosetta Predictions human pricing
XR_041647 Rosetta Predictions human pricing
XR_041648 Rosetta Predictions human pricing
XR_041649 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049275 predicted 1034
2 SASI_Hs01_00049276 predicted 703
3 SASI_Hs01_00049277 predicted 707
4 SASI_Hs01_00049278 predicted 657
5 SASI_Hs01_00049279 predicted 1028
6 SASI_Hs01_00049280 predicted 670
7 SASI_Hs01_00049281 predicted 610
8 SASI_Hs01_00049282 predicted 627
9 SASI_Hs01_00049283 predicted 662
10 SASI_Hs01_00049284 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529189 predicted 206
2 SASI_Hs02_00529190 predicted 215
3 SASI_Hs02_00529191 predicted 234
4 SASI_Hs02_00529192 predicted 232
5 SASI_Hs02_00529193 predicted 207
6 SASI_Hs02_00529194 predicted 198
7 SASI_Hs02_00529195 predicted 208
8 SASI_Hs02_00529196 predicted 50
9 SASI_Hs02_00529197 predicted 69
10 SASI_Hs02_00529198 predicted 49
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529199 predicted 206
2 SASI_Hs02_00529200 predicted 215
3 SASI_Hs02_00529201 predicted 229
4 SASI_Hs02_00529202 predicted 228
5 SASI_Hs02_00529203 predicted 208
6 SASI_Hs02_00529204 predicted 206
7 SASI_Hs02_00529205 predicted 207
8 SASI_Hs02_00529206 predicted 51
9 SASI_Hs02_00529207 predicted 63
10 SASI_Hs02_00529208 predicted 44
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529209 predicted 206
2 SASI_Hs02_00529210 predicted 209
3 SASI_Hs02_00529211 predicted 233
4 SASI_Hs02_00529212 predicted 231
5 SASI_Hs02_00529213 predicted 199
6 SASI_Hs02_00529214 predicted 203
7 SASI_Hs02_00529215 predicted 208
8 SASI_Hs02_00529216 predicted 49
9 SASI_Hs02_00529217 predicted 63
10 SASI_Hs02_00529218 predicted 47
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207473
FLJ41733 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-775s1c1
Sequence:CCGGCCCAGTAAGAGGATGGACTTTCTCGAGAAAGTCCATCCTCTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-217s1c1
Sequence:CCGGGTGCTGGTTACAGATGATCCTCTCGAGAGGATCATCTGTAACCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2349s1c1
Sequence:CCGGCCTTGGGATCAACTGCTTCATCTCGAGATGAAGCAGTTGATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-665s1c1
Sequence:CCGGCCCTTAGCTCTAAGGTGCTAACTCGAGTTAGCACCTTAGAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2350s1c1
Sequence:CCGGCTTGGGATCAACTGCTTCATTCTCGAGAATGAAGCAGTTGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-1630s1c1
Sequence:CCGGCCTTTGTCACACACTCTTCTTCTCGAGAAGAAGAGTGTGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-219s1c1
Sequence:CCGGGCTGGTTACAGATGATCCTCACTCGAGTGAGGATCATCTGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207473
FLJ41733 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-775s1c1
Sequence:CCGGCCCAGTAAGAGGATGGACTTTCTCGAGAAAGTCCATCCTCTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-217s1c1
Sequence:CCGGGTGCTGGTTACAGATGATCCTCTCGAGAGGATCATCTGTAACCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2349s1c1
Sequence:CCGGCCTTGGGATCAACTGCTTCATCTCGAGATGAAGCAGTTGATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-665s1c1
Sequence:CCGGCCCTTAGCTCTAAGGTGCTAACTCGAGTTAGCACCTTAGAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2350s1c1
Sequence:CCGGCTTGGGATCAACTGCTTCATTCTCGAGAATGAAGCAGTTGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-1630s1c1
Sequence:CCGGCCTTTGTCACACACTCTTCTTCTCGAGAAGAAGAGTGTGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-219s1c1
Sequence:CCGGGCTGGTTACAGATGATCCTCACTCGAGTGAGGATCATCTGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207473
FLJ41733 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-775s1c1
Sequence:CCGGCCCAGTAAGAGGATGGACTTTCTCGAGAAAGTCCATCCTCTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-217s1c1
Sequence:CCGGGTGCTGGTTACAGATGATCCTCTCGAGAGGATCATCTGTAACCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2349s1c1
Sequence:CCGGCCTTGGGATCAACTGCTTCATCTCGAGATGAAGCAGTTGATCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-665s1c1
Sequence:CCGGCCCTTAGCTCTAAGGTGCTAACTCGAGTTAGCACCTTAGAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-2350s1c1
Sequence:CCGGCTTGGGATCAACTGCTTCATTCTCGAGAATGAAGCAGTTGATCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164368    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207473.1-1630s1c1
Sequence:CCGGCCTTTGTCACACACTCTTCTTCTCGAGAAGAAGAGTGTGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207473.1-219s1c1
Sequence:CCGGGCTGGTTACAGATGATCCTCACTCGAGTGAGGATCATCTGTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks