EMAIL THIS PAGE TO A FRIEND

FLJ42102

40 Gene Product Result for
Species: Human FLJ42102(399923)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001680 Rosetta Predictions human pricing
XR_017701 Rosetta Predictions human pricing
XR_017872 Rosetta Predictions human pricing
XR_040388 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167068 predicted 1276
2 SASI_Hs01_00167069 predicted 1307
3 SASI_Hs01_00167070 predicted 1359
4 SASI_Hs01_00167071 predicted 1308
5 SASI_Hs01_00167072 predicted 1351
6 SASI_Hs01_00167073 predicted 1336
7 SASI_Hs01_00167074 predicted 1240
8 SASI_Hs01_00167075 predicted 1276
9 SASI_Hs01_00167076 predicted 1315
10 SASI_Hs01_00167077 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494042 predicted 105
2 SASI_Hs02_00494043 predicted 296
3 SASI_Hs02_00494044 predicted 27
4 SASI_Hs02_00494045 predicted 42
5 SASI_Hs02_00494046 predicted 154
6 SASI_Hs02_00494047 predicted 176
7 SASI_Hs02_00494048 predicted 76
8 SASI_Hs02_00494049 predicted 119
9 SASI_Hs02_00494050 predicted 320
10 SASI_Hs02_00494051 predicted 142
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494800 predicted 112
2 SASI_Hs02_00494801 predicted 301
3 SASI_Hs02_00494802 predicted 31
4 SASI_Hs02_00494803 predicted 41
5 SASI_Hs02_00494804 predicted 154
6 SASI_Hs02_00494805 predicted 172
7 SASI_Hs02_00494806 predicted 73
8 SASI_Hs02_00494807 predicted 121
9 SASI_Hs02_00494808 predicted 319
10 SASI_Hs02_00494809 predicted 136
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518421 predicted 109
2 SASI_Hs02_00518422 predicted 296
3 SASI_Hs02_00518423 predicted 30
4 SASI_Hs02_00518424 predicted 40
5 SASI_Hs02_00518425 predicted 155
6 SASI_Hs02_00518426 predicted 176
7 SASI_Hs02_00518427 predicted 70
8 SASI_Hs02_00518428 predicted 114
9 SASI_Hs02_00518429 predicted 318
10 SASI_Hs02_00518430 predicted 141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001680
FLJ42102 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1354s1c1
Sequence:CCGGGCAGTGTTTCTAATTATCCAACTCGAGTTGGATAATTAGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001680.1-1760s1c1
Sequence:CCGGGAATGTATGTTTGGTGCAGTTCTCGAGAACTGCACCAAACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1465s1c1
Sequence:CCGGGATTTCCTCCTCGTTGTCCAACTCGAGTTGGACAACGAGGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001680
FLJ42102 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1354s1c1
Sequence:CCGGGCAGTGTTTCTAATTATCCAACTCGAGTTGGATAATTAGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001680.1-1760s1c1
Sequence:CCGGGAATGTATGTTTGGTGCAGTTCTCGAGAACTGCACCAAACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1465s1c1
Sequence:CCGGGATTTCCTCCTCGTTGTCCAACTCGAGTTGGACAACGAGGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001680
FLJ42102 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1354s1c1
Sequence:CCGGGCAGTGTTTCTAATTATCCAACTCGAGTTGGATAATTAGAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001680.1-1760s1c1
Sequence:CCGGGAATGTATGTTTGGTGCAGTTCTCGAGAACTGCACCAAACATACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001680.1-1465s1c1
Sequence:CCGGGATTTCCTCCTCGTTGTCCAACTCGAGTTGGACAACGAGGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks