EMAIL THIS PAGE TO A FRIEND

FLJ42258

41 Gene Product Result for
Species: Human FLJ42258(440049)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004327 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160901 MISSION® esiRNA esiRNA human FLJ42258 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004327 Rosetta Predictions human pricing
XR_040625 Rosetta Predictions human pricing
XR_040626 Rosetta Predictions human pricing
XR_040627 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103951 predicted 692
2 SASI_Hs01_00103952 predicted 698
3 SASI_Hs01_00103953 predicted 1117
4 SASI_Hs01_00103954 predicted 922
5 SASI_Hs01_00103955 predicted 695
6 SASI_Hs01_00103956 predicted 849
7 SASI_Hs01_00103957 predicted 1143
8 SASI_Hs01_00103958 predicted 746
9 SASI_Hs01_00103959 predicted 1102
10 SASI_Hs01_00103960 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520510 predicted 371
2 SASI_Hs02_00520511 predicted 622
3 SASI_Hs02_00520512 predicted 681
4 SASI_Hs02_00520513 predicted 194
5 SASI_Hs02_00520514 predicted 688
6 SASI_Hs02_00520515 predicted 366
7 SASI_Hs02_00520516 predicted 926
8 SASI_Hs02_00520517 predicted 687
9 SASI_Hs02_00520518 predicted 836
10 SASI_Hs02_00520519 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520520 predicted 370
2 SASI_Hs02_00520521 predicted 618
3 SASI_Hs02_00520522 predicted 681
4 SASI_Hs02_00520523 predicted 200
5 SASI_Hs02_00520524 predicted 693
6 SASI_Hs02_00520525 predicted 374
7 SASI_Hs02_00520526 predicted 922
8 SASI_Hs02_00520527 predicted 688
9 SASI_Hs02_00520528 predicted 840
10 SASI_Hs02_00520529 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520530 predicted 376
2 SASI_Hs02_00520531 predicted 626
3 SASI_Hs02_00520532 predicted 687
4 SASI_Hs02_00520533 predicted 194
5 SASI_Hs02_00520534 predicted 687
6 SASI_Hs02_00520535 predicted 365
7 SASI_Hs02_00520536 predicted 919
8 SASI_Hs02_00520537 predicted 692
9 SASI_Hs02_00520538 predicted 844
10 SASI_Hs02_00520539 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004327
FLJ42258 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000173088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004327.1-703s1c1
Sequence:CCGGCTTGTGACAACTCTAGGTGCTCTCGAGAGCACCTAGAGTTGTCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004327.1-2058s1c1
Sequence:CCGGGCAAACAATGTGAAAGAGATACTCGAGTATCTCTTTCACATTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004327
FLJ42258 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000173088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004327.1-703s1c1
Sequence:CCGGCTTGTGACAACTCTAGGTGCTCTCGAGAGCACCTAGAGTTGTCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004327.1-2058s1c1
Sequence:CCGGGCAAACAATGTGAAAGAGATACTCGAGTATCTCTTTCACATTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004327
FLJ42258 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000173088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004327.1-703s1c1
Sequence:CCGGCTTGTGACAACTCTAGGTGCTCTCGAGAGCACCTAGAGTTGTCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004327.1-2058s1c1
Sequence:CCGGGCAAACAATGTGAAAGAGATACTCGAGTATCTCTTTCACATTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)