EMAIL THIS PAGE TO A FRIEND

FLJ42393

42 Gene Product Result for
Synonyms: AVPC1948
Species: Human FLJ42393(401105)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207488 Rosetta Predictions human pricing
XR_041589 Rosetta Predictions human pricing
XR_041590 Rosetta Predictions human pricing
XR_041591 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122130 predicted 1310
2 SASI_Hs01_00122131 predicted 1427
3 SASI_Hs01_00122132 predicted 1134
4 SASI_Hs01_00122133 predicted 874
5 SASI_Hs01_00122134 predicted 815
6 SASI_Hs01_00122135 predicted 991
7 SASI_Hs01_00122136 predicted 949
8 SASI_Hs01_00122137 predicted 1496
9 SASI_Hs01_00122138 predicted 1415
10 SASI_Hs01_00122139 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528642 predicted 1298
2 SASI_Hs02_00528643 predicted 1419
3 SASI_Hs02_00528644 predicted 1121
4 SASI_Hs02_00528645 predicted 868
5 SASI_Hs02_00528646 predicted 804
6 SASI_Hs02_00528647 predicted 986
7 SASI_Hs02_00528648 predicted 943
8 SASI_Hs02_00528649 predicted 1496
9 SASI_Hs02_00528650 predicted 1407
10 SASI_Hs02_00528651 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528652 predicted 1299
2 SASI_Hs02_00528653 predicted 1420
3 SASI_Hs02_00528654 predicted 1121
4 SASI_Hs02_00528655 predicted 869
5 SASI_Hs02_00528656 predicted 805
6 SASI_Hs02_00528657 predicted 987
7 SASI_Hs02_00528658 predicted 945
8 SASI_Hs02_00528659 predicted 1490
9 SASI_Hs02_00528660 predicted 1402
10 SASI_Hs02_00528661 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528662 predicted 1301
2 SASI_Hs02_00528663 predicted 951
3 SASI_Hs02_00528664 predicted 1417
4 SASI_Hs02_00528665 predicted 1124
5 SASI_Hs02_00528666 predicted 868
6 SASI_Hs02_00528667 predicted 810
7 SASI_Hs02_00528668 predicted 980
8 SASI_Hs02_00528669 predicted 1493
9 SASI_Hs02_00528670 predicted 1412
10 SASI_Hs02_00528671 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207488
FLJ42393 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1922s1c1
Sequence:CCGGCCTCTTTCTTGAACCTCCTTACTCGAGTAAGGAGGTTCAAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-736s1c1
Sequence:CCGGCTTCTTTATCTGACCCGTGCACTCGAGTGCACGGGTCAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-826s1c1
Sequence:CCGGCAGTTCATTTCCCGCCTTGTTCTCGAGAACAAGGCGGGAAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-950s1c1
Sequence:CCGGCACTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-814s1c1
Sequence:CCGGCCTTCAGCTCTCCAGTTCATTCTCGAGAATGAACTGGAGAGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-672s1c1
Sequence:CCGGCGTGAAGAGCATGCATGGAATCTCGAGATTCCATGCATGCTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-984s1c1
Sequence:CCGGGTTCCTCTCGTGCTCTCATATCTCGAGATATGAGAGCACGAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1041s1c1
Sequence:CCGGCCAGCAGCATTCCTTCTAGTTCTCGAGAACTAGAAGGAATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-726s1c1
Sequence:CCGGCACAGCGGAGCTTCTTTATCTCTCGAGAGATAAAGAAGCTCCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1433s1c1
Sequence:CCGGGCTTGGCCAATAAGAATGTATCTCGAGATACATTCTTATTGGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1544s1c1
Sequence:CCGGGCAATGAGTGTAAGACACTTACTCGAGTAAGTGTCTTACACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207488
FLJ42393 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1922s1c1
Sequence:CCGGCCTCTTTCTTGAACCTCCTTACTCGAGTAAGGAGGTTCAAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-736s1c1
Sequence:CCGGCTTCTTTATCTGACCCGTGCACTCGAGTGCACGGGTCAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-826s1c1
Sequence:CCGGCAGTTCATTTCCCGCCTTGTTCTCGAGAACAAGGCGGGAAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-950s1c1
Sequence:CCGGCACTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-814s1c1
Sequence:CCGGCCTTCAGCTCTCCAGTTCATTCTCGAGAATGAACTGGAGAGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-672s1c1
Sequence:CCGGCGTGAAGAGCATGCATGGAATCTCGAGATTCCATGCATGCTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-984s1c1
Sequence:CCGGGTTCCTCTCGTGCTCTCATATCTCGAGATATGAGAGCACGAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1041s1c1
Sequence:CCGGCCAGCAGCATTCCTTCTAGTTCTCGAGAACTAGAAGGAATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-726s1c1
Sequence:CCGGCACAGCGGAGCTTCTTTATCTCTCGAGAGATAAAGAAGCTCCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1433s1c1
Sequence:CCGGGCTTGGCCAATAAGAATGTATCTCGAGATACATTCTTATTGGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1544s1c1
Sequence:CCGGGCAATGAGTGTAAGACACTTACTCGAGTAAGTGTCTTACACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207488
FLJ42393 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1922s1c1
Sequence:CCGGCCTCTTTCTTGAACCTCCTTACTCGAGTAAGGAGGTTCAAGAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-736s1c1
Sequence:CCGGCTTCTTTATCTGACCCGTGCACTCGAGTGCACGGGTCAGATAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-826s1c1
Sequence:CCGGCAGTTCATTTCCCGCCTTGTTCTCGAGAACAAGGCGGGAAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-950s1c1
Sequence:CCGGCACTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-814s1c1
Sequence:CCGGCCTTCAGCTCTCCAGTTCATTCTCGAGAATGAACTGGAGAGCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-672s1c1
Sequence:CCGGCGTGAAGAGCATGCATGGAATCTCGAGATTCCATGCATGCTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207488.1-984s1c1
Sequence:CCGGGTTCCTCTCGTGCTCTCATATCTCGAGATATGAGAGCACGAGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1041s1c1
Sequence:CCGGCCAGCAGCATTCCTTCTAGTTCTCGAGAACTAGAAGGAATGCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207488.1-726s1c1
Sequence:CCGGCACAGCGGAGCTTCTTTATCTCTCGAGAGATAAAGAAGCTCCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207488.1-1433s1c1
Sequence:CCGGGCTTGGCCAATAAGAATGTATCTCGAGATACATTCTTATTGGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207488.1-1544s1c1
Sequence:CCGGGCAATGAGTGTAAGACACTTACTCGAGTAAGTGTCTTACACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376290
FLJ42393 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-952s1c1
Sequence:CCGGCGCTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-994s1c1
Sequence:CCGGCGTGCTCTCATATTTCCATTTCTCGAGAAATGGAAATATGAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-876s1c1
Sequence:CCGGCCACCTGACATTCTGTCCTTTCTCGAGAAAGGACAGAATGTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376290
FLJ42393 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-952s1c1
Sequence:CCGGCGCTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-994s1c1
Sequence:CCGGCGTGCTCTCATATTTCCATTTCTCGAGAAATGGAAATATGAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-876s1c1
Sequence:CCGGCCACCTGACATTCTGTCCTTTCTCGAGAAAGGACAGAATGTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376290
FLJ42393 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-952s1c1
Sequence:CCGGCGCTTGTTTGCCCAGTGCATTCTCGAGAATGCACTGGGCAAACAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-994s1c1
Sequence:CCGGCGTGCTCTCATATTTCCATTTCTCGAGAAATGGAAATATGAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376290.1-876s1c1
Sequence:CCGGCCACCTGACATTCTGTCCTTTCTCGAGAAAGGACAGAATGTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks