EMAIL THIS PAGE TO A FRIEND

FLJ42842

77 Gene Product Result for
Species: Human FLJ42842(440446)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004335 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116905 predicted 1363
2 SASI_Hs01_00116906 predicted 1365
3 SASI_Hs01_00116907 predicted 1419
4 SASI_Hs01_00116908 predicted 1002
5 SASI_Hs01_00116909 predicted 1069
6 SASI_Hs01_00116910 predicted 1425
7 SASI_Hs01_00116911 predicted 1087
8 SASI_Hs01_00116912 predicted 1121
9 SASI_Hs01_00116913 predicted 972
10 SASI_Hs01_00116914 predicted 1144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004335
FLJ42842 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-455s1c1
Sequence:CCGGGTTTCCAGAGGAGACTCACATCTCGAGATGTGAGTCTCCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-945s1c1
Sequence:CCGGCCTGTTCTTCAAGAAGCAGTACTCGAGTACTGCTTCTTGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-1447s1c1
Sequence:CCGGCCAATCCAAGAATGTTTGATTCTCGAGAATCAAACATTCTTGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-650s1c1
Sequence:CCGGGATTCTAGGACTTGTACCAATCTCGAGATTGGTACAAGTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-2207s1c1
Sequence:CCGGCCAATACAAAGTTCCACACTACTCGAGTAGTGTGGAACTTTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-731s1c1
Sequence:CCGGGATTCTGAGGCTTCTGGACTTCTCGAGAAGTCCAGAAGCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-909s1c1
Sequence:CCGGCAGATATGGAGCATTTGAAATCTCGAGATTTCAAATGCTCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-894s1c1
Sequence:CCGGGAACCTTGACTAATACAGATACTCGAGTATCTGTATTAGTCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-903s1c1
Sequence:CCGGCTAATACAGATATGGAGCATTCTCGAGAATGCTCCATATCTGTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-2208s1c1
Sequence:CCGGCAATACAAAGTTCCACACTAACTCGAGTTAGTGTGGAACTTTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004335
FLJ42842 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-455s1c1
Sequence:CCGGGTTTCCAGAGGAGACTCACATCTCGAGATGTGAGTCTCCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-945s1c1
Sequence:CCGGCCTGTTCTTCAAGAAGCAGTACTCGAGTACTGCTTCTTGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-1447s1c1
Sequence:CCGGCCAATCCAAGAATGTTTGATTCTCGAGAATCAAACATTCTTGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-650s1c1
Sequence:CCGGGATTCTAGGACTTGTACCAATCTCGAGATTGGTACAAGTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-2207s1c1
Sequence:CCGGCCAATACAAAGTTCCACACTACTCGAGTAGTGTGGAACTTTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-731s1c1
Sequence:CCGGGATTCTGAGGCTTCTGGACTTCTCGAGAAGTCCAGAAGCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-909s1c1
Sequence:CCGGCAGATATGGAGCATTTGAAATCTCGAGATTTCAAATGCTCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-894s1c1
Sequence:CCGGGAACCTTGACTAATACAGATACTCGAGTATCTGTATTAGTCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-903s1c1
Sequence:CCGGCTAATACAGATATGGAGCATTCTCGAGAATGCTCCATATCTGTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-2208s1c1
Sequence:CCGGCAATACAAAGTTCCACACTAACTCGAGTTAGTGTGGAACTTTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004335
FLJ42842 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-455s1c1
Sequence:CCGGGTTTCCAGAGGAGACTCACATCTCGAGATGTGAGTCTCCTCTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-945s1c1
Sequence:CCGGCCTGTTCTTCAAGAAGCAGTACTCGAGTACTGCTTCTTGAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-1447s1c1
Sequence:CCGGCCAATCCAAGAATGTTTGATTCTCGAGAATCAAACATTCTTGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-650s1c1
Sequence:CCGGGATTCTAGGACTTGTACCAATCTCGAGATTGGTACAAGTCCTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162205    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004335.1-2207s1c1
Sequence:CCGGCCAATACAAAGTTCCACACTACTCGAGTAGTGTGGAACTTTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004335.1-731s1c1
Sequence:CCGGGATTCTGAGGCTTCTGGACTTCTCGAGAAGTCCAGAAGCCTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-909s1c1
Sequence:CCGGCAGATATGGAGCATTTGAAATCTCGAGATTTCAAATGCTCCATATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-894s1c1
Sequence:CCGGGAACCTTGACTAATACAGATACTCGAGTATCTGTATTAGTCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004335.1-903s1c1
Sequence:CCGGCTAATACAGATATGGAGCATTCTCGAGAATGCTCCATATCTGTATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004335.1-2208s1c1
Sequence:CCGGCAATACAAAGTTCCACACTAACTCGAGTTAGTGTGGAACTTTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks