EMAIL THIS PAGE TO A FRIEND

FLJ43879

42 Gene Product Result for
Species: Human FLJ43879(401039)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001698 Rosetta Predictions human pricing
XR_041559 Rosetta Predictions human pricing
XR_041560 Rosetta Predictions human pricing
XR_041561 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098132 predicted 1324
2 SASI_Hs01_00098133 predicted 1308
3 SASI_Hs01_00098134 predicted 1355
4 SASI_Hs01_00098135 predicted 653
5 SASI_Hs01_00098136 predicted 985
6 SASI_Hs01_00098137 predicted 1321
7 SASI_Hs01_00098138 predicted 478
8 SASI_Hs01_00098139 predicted 1277
9 SASI_Hs01_00098140 predicted 1290
10 SASI_Hs01_00098141 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528361 predicted 422
2 SASI_Hs02_00528362 predicted 556
3 SASI_Hs02_00528363 predicted 683
4 SASI_Hs02_00528364 predicted 247
5 SASI_Hs02_00528365 predicted 526
6 SASI_Hs02_00528366 predicted 562
7 SASI_Hs02_00528367 predicted 596
8 SASI_Hs02_00528368 predicted 336
9 SASI_Hs02_00528369 predicted 629
10 SASI_Hs02_00528370 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528371 predicted 428
2 SASI_Hs02_00528372 predicted 551
3 SASI_Hs02_00528373 predicted 679
4 SASI_Hs02_00528374 predicted 246
5 SASI_Hs02_00528375 predicted 526
6 SASI_Hs02_00528376 predicted 562
7 SASI_Hs02_00528377 predicted 600
8 SASI_Hs02_00528378 predicted 335
9 SASI_Hs02_00528379 predicted 635
10 SASI_Hs02_00528380 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528381 predicted 422
2 SASI_Hs02_00528382 predicted 548
3 SASI_Hs02_00528383 predicted 678
4 SASI_Hs02_00528384 predicted 246
5 SASI_Hs02_00528385 predicted 525
6 SASI_Hs02_00528386 predicted 558
7 SASI_Hs02_00528387 predicted 597
8 SASI_Hs02_00528388 predicted 342
9 SASI_Hs02_00528389 predicted 634
10 SASI_Hs02_00528390 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001698
FLJ43879 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-255s1c1
Sequence:CCGGCAACCGAAGGAGAGACAACATCTCGAGATGTTGTCTCTCCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-332s1c1
Sequence:CCGGGCTTGGAGTGCAGCAAATGTTCTCGAGAACATTTGCTGCACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-258s1c1
Sequence:CCGGCCGAAGGAGAGACAACATTCACTCGAGTGAATGTTGTCTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-658s1c1
Sequence:CCGGGTTCTCCATCTACTTCTCCCACTCGAGTGGGAGAAGTAGATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-475s1c1
Sequence:CCGGCTGTAAGCCCTGGAATGCAAACTCGAGTTTGCATTCCAGGGCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-567s1c1
Sequence:CCGGCCCAGATGGAAGCAAAGACAACTCGAGTTGTCTTTGCTTCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-646s1c1
Sequence:CCGGGCTCTGTACAGAGTTCTCCATCTCGAGATGGAGAACTCTGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001698
FLJ43879 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-255s1c1
Sequence:CCGGCAACCGAAGGAGAGACAACATCTCGAGATGTTGTCTCTCCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-332s1c1
Sequence:CCGGGCTTGGAGTGCAGCAAATGTTCTCGAGAACATTTGCTGCACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-258s1c1
Sequence:CCGGCCGAAGGAGAGACAACATTCACTCGAGTGAATGTTGTCTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-658s1c1
Sequence:CCGGGTTCTCCATCTACTTCTCCCACTCGAGTGGGAGAAGTAGATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-475s1c1
Sequence:CCGGCTGTAAGCCCTGGAATGCAAACTCGAGTTTGCATTCCAGGGCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-567s1c1
Sequence:CCGGCCCAGATGGAAGCAAAGACAACTCGAGTTGTCTTTGCTTCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-646s1c1
Sequence:CCGGGCTCTGTACAGAGTTCTCCATCTCGAGATGGAGAACTCTGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001698
FLJ43879 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-255s1c1
Sequence:CCGGCAACCGAAGGAGAGACAACATCTCGAGATGTTGTCTCTCCTTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-332s1c1
Sequence:CCGGGCTTGGAGTGCAGCAAATGTTCTCGAGAACATTTGCTGCACTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-258s1c1
Sequence:CCGGCCGAAGGAGAGACAACATTCACTCGAGTGAATGTTGTCTCTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-658s1c1
Sequence:CCGGGTTCTCCATCTACTTCTCCCACTCGAGTGGGAGAAGTAGATGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-475s1c1
Sequence:CCGGCTGTAAGCCCTGGAATGCAAACTCGAGTTTGCATTCCAGGGCTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-567s1c1
Sequence:CCGGCCCAGATGGAAGCAAAGACAACTCGAGTTGTCTTTGCTTCCATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001698.1-646s1c1
Sequence:CCGGGCTCTGTACAGAGTTCTCCATCTCGAGATGGAGAACTCTGTACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks