EMAIL THIS PAGE TO A FRIEND

FLJ44006

40 Gene Product Result for
Species: Human FLJ44006(400997)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_379122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001696 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001696 Rosetta Predictions human pricing
XR_041547 Rosetta Predictions human pricing
XR_041548 Rosetta Predictions human pricing
XR_041549 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084079 predicted 1373
2 SASI_Hs01_00084080 predicted 1412
3 SASI_Hs01_00084081 predicted 911
4 SASI_Hs01_00084082 predicted 1094
5 SASI_Hs01_00084083 predicted 1191
6 SASI_Hs01_00084084 predicted 1562
7 SASI_Hs01_00084085 predicted 1379
8 SASI_Hs01_00084086 predicted 793
9 SASI_Hs01_00084087 predicted 1070
10 SASI_Hs01_00084088 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528271 predicted 13
2 SASI_Hs02_00528272 predicted 158
3 SASI_Hs02_00528273 predicted 183
4 SASI_Hs02_00528274 predicted 105
5 SASI_Hs02_00528275 predicted 63
6 SASI_Hs02_00528276 predicted 328
7 SASI_Hs02_00528277 predicted 76
8 SASI_Hs02_00528278 predicted 92
9 SASI_Hs02_00528279 predicted 77
10 SASI_Hs02_00528280 predicted 141
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528281 predicted 9
2 SASI_Hs02_00528282 predicted 156
3 SASI_Hs02_00528283 predicted 182
4 SASI_Hs02_00528284 predicted 102
5 SASI_Hs02_00528285 predicted 58
6 SASI_Hs02_00528286 predicted 334
7 SASI_Hs02_00528287 predicted 78
8 SASI_Hs02_00528288 predicted 93
9 SASI_Hs02_00528289 predicted 83
10 SASI_Hs02_00528290 predicted 142
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528291 predicted 14
2 SASI_Hs02_00528292 predicted 153
3 SASI_Hs02_00528293 predicted 181
4 SASI_Hs02_00528294 predicted 98
5 SASI_Hs02_00528295 predicted 57
6 SASI_Hs02_00528296 predicted 331
7 SASI_Hs02_00528297 predicted 76
8 SASI_Hs02_00528298 predicted 94
9 SASI_Hs02_00528299 predicted 81
10 SASI_Hs02_00528300 predicted 140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379122
FLJ44006 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379122.1-305s1c1
Sequence:CCGGGAGAATAAAGCAAGATGCCATCTCGAGATGGCATCTTGCTTTATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-2798s1c1
Sequence:CCGGCCCAGGATTCAATACATGATACTCGAGTATCATGTATTGAATCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-1065s1c1
Sequence:CCGGGCTCACATGATTCCATTATTTCTCGAGAAATAATGGAATCATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379122.1-178s1c1
Sequence:CCGGGCTTTCAAATCAAAGAGGATTCTCGAGAATCCTCTTTGATTTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379122
FLJ44006 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379122.1-305s1c1
Sequence:CCGGGAGAATAAAGCAAGATGCCATCTCGAGATGGCATCTTGCTTTATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-2798s1c1
Sequence:CCGGCCCAGGATTCAATACATGATACTCGAGTATCATGTATTGAATCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-1065s1c1
Sequence:CCGGGCTCACATGATTCCATTATTTCTCGAGAAATAATGGAATCATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379122.1-178s1c1
Sequence:CCGGGCTTTCAAATCAAAGAGGATTCTCGAGAATCCTCTTTGATTTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379122
FLJ44006 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379122.1-305s1c1
Sequence:CCGGGAGAATAAAGCAAGATGCCATCTCGAGATGGCATCTTGCTTTATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121606    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-2798s1c1
Sequence:CCGGCCCAGGATTCAATACATGATACTCGAGTATCATGTATTGAATCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379122.1-1065s1c1
Sequence:CCGGGCTCACATGATTCCATTATTTCTCGAGAAATAATGGAATCATGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379122.1-178s1c1
Sequence:CCGGGCTTTCAAATCAAAGAGGATTCTCGAGAATCCTCTTTGATTTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001696
FLJ44006 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000143597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-2347s1c1
Sequence:CCGGGCTAGAATCTTCGACAGTCATCTCGAGATGACTGTCGAAGATTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-1574s1c1
Sequence:CCGGGCTACTCACTAATGCTGATAACTCGAGTTATCAGCATTAGTGAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001696
FLJ44006 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000143597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-2347s1c1
Sequence:CCGGGCTAGAATCTTCGACAGTCATCTCGAGATGACTGTCGAAGATTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-1574s1c1
Sequence:CCGGGCTACTCACTAATGCTGATAACTCGAGTTATCAGCATTAGTGAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001696
FLJ44006 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000143597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-2347s1c1
Sequence:CCGGGCTAGAATCTTCGACAGTCATCTCGAGATGACTGTCGAAGATTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001696.1-1574s1c1
Sequence:CCGGGCTACTCACTAATGCTGATAACTCGAGTTATCAGCATTAGTGAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)