EMAIL THIS PAGE TO A FRIEND

FLJ44313

Species: Human FLJ44313(400658)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207460 Rosetta Predictions human pricing
XR_039915 Rosetta Predictions human pricing
XR_039916 Rosetta Predictions human pricing
XR_039917 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130821 predicted 1000
2 SASI_Hs01_00130822 predicted 884
3 SASI_Hs01_00130823 predicted 1147
4 SASI_Hs01_00130824 predicted 1004
5 SASI_Hs01_00130825 predicted 806
6 SASI_Hs01_00130826 predicted 875
7 SASI_Hs01_00130827 predicted 1030
8 SASI_Hs01_00130828 predicted 990
9 SASI_Hs01_00130829 predicted 855
10 SASI_Hs01_00130830 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514213 predicted 1275
2 SASI_Hs02_00514214 predicted 268
3 SASI_Hs02_00514215 predicted 800
4 SASI_Hs02_00514216 predicted 1416
5 SASI_Hs02_00514217 predicted 1503
6 SASI_Hs02_00514218 predicted 977
7 SASI_Hs02_00514219 predicted 852
8 SASI_Hs02_00514220 predicted 1123
9 SASI_Hs02_00514221 predicted 1259
10 SASI_Hs02_00514222 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514223 predicted 1276
2 SASI_Hs02_00514224 predicted 268
3 SASI_Hs02_00514225 predicted 798
4 SASI_Hs02_00514226 predicted 1420
5 SASI_Hs02_00514227 predicted 1496
6 SASI_Hs02_00514228 predicted 982
7 SASI_Hs02_00514229 predicted 855
8 SASI_Hs02_00514230 predicted 1119
9 SASI_Hs02_00514231 predicted 1265
10 SASI_Hs02_00514232 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514233 predicted 1281
2 SASI_Hs02_00514234 predicted 275
3 SASI_Hs02_00514235 predicted 801
4 SASI_Hs02_00514236 predicted 1416
5 SASI_Hs02_00514237 predicted 1499
6 SASI_Hs02_00514238 predicted 977
7 SASI_Hs02_00514239 predicted 853
8 SASI_Hs02_00514240 predicted 1113
9 SASI_Hs02_00514241 predicted 1264
10 SASI_Hs02_00514242 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207460
FLJ44313 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-525s1c1
Sequence:CCGGGCATTCTGCATGTGTGATGTTCTCGAGAACATCACACATGCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207460.1-1513s1c1
Sequence:CCGGCCTGTAACCATATTTAGCATTCTCGAGAATGCTAAATATGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-282s1c1
Sequence:CCGGGTTCTCCTTCTCCTCGTGATACTCGAGTATCACGAGGAGAAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-275s1c1
Sequence:CCGGCCGTATTGTTCTCCTTCTCCTCTCGAGAGGAGAAGGAGAACAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-435s1c1
Sequence:CCGGCCCAACTTAGGGCGTTTACAACTCGAGTTGTAAACGCCCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207460
FLJ44313 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-525s1c1
Sequence:CCGGGCATTCTGCATGTGTGATGTTCTCGAGAACATCACACATGCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207460.1-1513s1c1
Sequence:CCGGCCTGTAACCATATTTAGCATTCTCGAGAATGCTAAATATGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-282s1c1
Sequence:CCGGGTTCTCCTTCTCCTCGTGATACTCGAGTATCACGAGGAGAAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-275s1c1
Sequence:CCGGCCGTATTGTTCTCCTTCTCCTCTCGAGAGGAGAAGGAGAACAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-435s1c1
Sequence:CCGGCCCAACTTAGGGCGTTTACAACTCGAGTTGTAAACGCCCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207460
FLJ44313 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-525s1c1
Sequence:CCGGGCATTCTGCATGTGTGATGTTCTCGAGAACATCACACATGCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207460.1-1513s1c1
Sequence:CCGGCCTGTAACCATATTTAGCATTCTCGAGAATGCTAAATATGGTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-282s1c1
Sequence:CCGGGTTCTCCTTCTCCTCGTGATACTCGAGTATCACGAGGAGAAGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-275s1c1
Sequence:CCGGCCGTATTGTTCTCCTTCTCCTCTCGAGAGGAGAAGGAGAACAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207460.1-435s1c1
Sequence:CCGGCCCAACTTAGGGCGTTTACAACTCGAGTTGTAAACGCCCTAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks