EMAIL THIS PAGE TO A FRIEND

FLJ44385

40 Gene Product Result for
Species: Human FLJ44385(400934)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376022 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207478 Rosetta Predictions human pricing
XR_041677 Rosetta Predictions human pricing
XR_041678 Rosetta Predictions human pricing
XR_041679 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177429 predicted 1826
2 SASI_Hs01_00177430 predicted 2065
3 SASI_Hs01_00177431 predicted 1898
4 SASI_Hs01_00177432 predicted 2071
5 SASI_Hs01_00177433 predicted 1517
6 SASI_Hs01_00177434 predicted 1776
7 SASI_Hs01_00177435 predicted 1803
8 SASI_Hs01_00177436 predicted 1385
9 SASI_Hs01_00177437 predicted 1723
10 SASI_Hs01_00177438 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529489 predicted 237
2 SASI_Hs02_00529490 predicted 233
3 SASI_Hs02_00529491 predicted 303
4 SASI_Hs02_00529492 predicted 303
5 SASI_Hs02_00529493 predicted 123
6 SASI_Hs02_00529494 predicted 331
7 SASI_Hs02_00529495 predicted 173
8 SASI_Hs02_00529496 predicted 263
9 SASI_Hs02_00529497 predicted 341
10 SASI_Hs02_00529498 predicted 108
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529499 predicted 233
2 SASI_Hs02_00529500 predicted 228
3 SASI_Hs02_00529501 predicted 296
4 SASI_Hs02_00529502 predicted 307
5 SASI_Hs02_00529503 predicted 115
6 SASI_Hs02_00529504 predicted 332
7 SASI_Hs02_00529505 predicted 171
8 SASI_Hs02_00529506 predicted 262
9 SASI_Hs02_00529507 predicted 106
10 SASI_Hs02_00529508 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529509 predicted 237
2 SASI_Hs02_00529510 predicted 235
3 SASI_Hs02_00529511 predicted 302
4 SASI_Hs02_00529512 predicted 307
5 SASI_Hs02_00529513 predicted 117
6 SASI_Hs02_00529514 predicted 332
7 SASI_Hs02_00529515 predicted 168
8 SASI_Hs02_00529516 predicted 266
9 SASI_Hs02_00529517 predicted 108
10 SASI_Hs02_00529518 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207478
FLJ44385 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1388s1c1
Sequence:CCGGCAGTTCTTCCAGAACATTCCACTCGAGTGGAATGTTCTGGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1551s1c1
Sequence:CCGGCAGAACTGCCCAAATCCAGAACTCGAGTTCTGGATTTGGGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-3540s1c1
Sequence:CCGGCAAAGCAGAAAGCCCAGCTTTCTCGAGAAAGCTGGGCTTTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1526s1c1
Sequence:CCGGCTTCAGTTGATGAGCTGCTTGCTCGAGCAAGCAGCTCATCAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1529s1c1
Sequence:CCGGCAGTTGATGAGCTGCTTGAGACTCGAGTCTCAAGCAGCTCATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1508s1c1
Sequence:CCGGCCATTCTGTCCTGTGTCACTTCTCGAGAAGTGACACAGGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1517s1c1
Sequence:CCGGCCTGTGTCACTTCAGTTGATGCTCGAGCATCAACTGAAGTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1451s1c1
Sequence:CCGGCTACTCAGTTCCTCCAGAACACTCGAGTGTTCTGGAGGAACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-2676s1c1
Sequence:CCGGCAAAGACATCATTGGCTACATCTCGAGATGTAGCCAATGATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207478
FLJ44385 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1388s1c1
Sequence:CCGGCAGTTCTTCCAGAACATTCCACTCGAGTGGAATGTTCTGGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1551s1c1
Sequence:CCGGCAGAACTGCCCAAATCCAGAACTCGAGTTCTGGATTTGGGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-3540s1c1
Sequence:CCGGCAAAGCAGAAAGCCCAGCTTTCTCGAGAAAGCTGGGCTTTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1526s1c1
Sequence:CCGGCTTCAGTTGATGAGCTGCTTGCTCGAGCAAGCAGCTCATCAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1529s1c1
Sequence:CCGGCAGTTGATGAGCTGCTTGAGACTCGAGTCTCAAGCAGCTCATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1508s1c1
Sequence:CCGGCCATTCTGTCCTGTGTCACTTCTCGAGAAGTGACACAGGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1517s1c1
Sequence:CCGGCCTGTGTCACTTCAGTTGATGCTCGAGCATCAACTGAAGTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1451s1c1
Sequence:CCGGCTACTCAGTTCCTCCAGAACACTCGAGTGTTCTGGAGGAACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-2676s1c1
Sequence:CCGGCAAAGACATCATTGGCTACATCTCGAGATGTAGCCAATGATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207478
FLJ44385 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1388s1c1
Sequence:CCGGCAGTTCTTCCAGAACATTCCACTCGAGTGGAATGTTCTGGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1551s1c1
Sequence:CCGGCAGAACTGCCCAAATCCAGAACTCGAGTTCTGGATTTGGGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-3540s1c1
Sequence:CCGGCAAAGCAGAAAGCCCAGCTTTCTCGAGAAAGCTGGGCTTTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1526s1c1
Sequence:CCGGCTTCAGTTGATGAGCTGCTTGCTCGAGCAAGCAGCTCATCAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1529s1c1
Sequence:CCGGCAGTTGATGAGCTGCTTGAGACTCGAGTCTCAAGCAGCTCATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207478.1-1508s1c1
Sequence:CCGGCCATTCTGTCCTGTGTCACTTCTCGAGAAGTGACACAGGACAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1517s1c1
Sequence:CCGGCCTGTGTCACTTCAGTTGATGCTCGAGCATCAACTGAAGTGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207478.1-1451s1c1
Sequence:CCGGCTACTCAGTTCCTCCAGAACACTCGAGTGTTCTGGAGGAACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207478.1-2676s1c1
Sequence:CCGGCAAAGACATCATTGGCTACATCTCGAGATGTAGCCAATGATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376022
FLJ44385 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376022.1-1561s1c1
Sequence:CCGGCAAATCCAGAACCGCCCACTACTCGAGTAGTGGGCGGTTCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376022.1-1785s1c1
Sequence:CCGGCCAAGGAGAGTCTGGGATTATCTCGAGATAATCCCAGACTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376022
FLJ44385 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376022.1-1561s1c1
Sequence:CCGGCAAATCCAGAACCGCCCACTACTCGAGTAGTGGGCGGTTCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376022.1-1785s1c1
Sequence:CCGGCCAAGGAGAGTCTGGGATTATCTCGAGATAATCCCAGACTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376022
FLJ44385 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376022.1-1561s1c1
Sequence:CCGGCAAATCCAGAACCGCCCACTACTCGAGTAGTGGGCGGTTCTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376022.1-1785s1c1
Sequence:CCGGCCAAGGAGAGTCTGGGATTATCTCGAGATAATCCCAGACTCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks