EMAIL THIS PAGE TO A FRIEND

FLJ44635

37 Gene Product Result for
Species: Human FLJ44635(392490)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301874 ANTI-FLJ44635 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207422 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207422 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170205 predicted 588
2 SASI_Hs01_00170206 predicted 813
3 SASI_Hs01_00170208 predicted 401
4 SASI_Hs01_00170209 predicted 812
5 SASI_Hs01_00170210 predicted 614
6 SASI_Hs01_00170211 predicted 620
7 SASI_Hs01_00170207 predicted 656
8 SASI_Hs01_00170212 predicted 799
9 SASI_Hs02_00374061 predicted 962
10 SASI_Hs02_00374062 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207422
FLJ44635 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-496s1c1
Sequence:CCGGGACTCGCTCATTGGTGGAAATCTCGAGATTTCCACCAATGAGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-473s1c1
Sequence:CCGGGTAGGACAGAAGGTAACATTTCTCGAGAAATGTTACCTTCTGTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207422.1-1756s1c1
Sequence:CCGGCCCAAATCCAAATCACTTCAACTCGAGTTGAAGTGATTTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207422.1-557s1c1
Sequence:CCGGCAGTAATCACTGGTGTCGATACTCGAGTATCGACACCAGTGATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-721s1c1
Sequence:CCGGGAACAGATCAAGCACATCCTTCTCGAGAAGGATGTGCTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-471s1c1
Sequence:CCGGCAGTAGGACAGAAGGTAACATCTCGAGATGTTACCTTCTGTCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-397s21c1
Sequence:CCGGGAGATGTTCTCTGACAGTTACCTCGAGGTAACTGTCAGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-627s21c1
Sequence:CCGGCAATAAGTGCATCAAAGATTACTCGAGTAATCTTTGATGCACTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207422.2-783s21c1
Sequence:CCGGATGGTTGCTCTGCGGACTACTCTCGAGAGTAGTCCGCAGAGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-585s21c1
Sequence:CCGGGAATCATCACCTGCAAGAAACCTCGAGGTTTCTTGCAGGTGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207422
FLJ44635 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-496s1c1
Sequence:CCGGGACTCGCTCATTGGTGGAAATCTCGAGATTTCCACCAATGAGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-473s1c1
Sequence:CCGGGTAGGACAGAAGGTAACATTTCTCGAGAAATGTTACCTTCTGTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207422.1-1756s1c1
Sequence:CCGGCCCAAATCCAAATCACTTCAACTCGAGTTGAAGTGATTTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207422.1-557s1c1
Sequence:CCGGCAGTAATCACTGGTGTCGATACTCGAGTATCGACACCAGTGATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-721s1c1
Sequence:CCGGGAACAGATCAAGCACATCCTTCTCGAGAAGGATGTGCTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-471s1c1
Sequence:CCGGCAGTAGGACAGAAGGTAACATCTCGAGATGTTACCTTCTGTCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-397s21c1
Sequence:CCGGGAGATGTTCTCTGACAGTTACCTCGAGGTAACTGTCAGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-627s21c1
Sequence:CCGGCAATAAGTGCATCAAAGATTACTCGAGTAATCTTTGATGCACTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207422.2-783s21c1
Sequence:CCGGATGGTTGCTCTGCGGACTACTCTCGAGAGTAGTCCGCAGAGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-585s21c1
Sequence:CCGGGAATCATCACCTGCAAGAAACCTCGAGGTTTCTTGCAGGTGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207422
FLJ44635 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-496s1c1
Sequence:CCGGGACTCGCTCATTGGTGGAAATCTCGAGATTTCCACCAATGAGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-473s1c1
Sequence:CCGGGTAGGACAGAAGGTAACATTTCTCGAGAAATGTTACCTTCTGTCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207422.1-1756s1c1
Sequence:CCGGCCCAAATCCAAATCACTTCAACTCGAGTTGAAGTGATTTGGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207422.1-557s1c1
Sequence:CCGGCAGTAATCACTGGTGTCGATACTCGAGTATCGACACCAGTGATTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-721s1c1
Sequence:CCGGGAACAGATCAAGCACATCCTTCTCGAGAAGGATGTGCTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207422.1-471s1c1
Sequence:CCGGCAGTAGGACAGAAGGTAACATCTCGAGATGTTACCTTCTGTCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-397s21c1
Sequence:CCGGGAGATGTTCTCTGACAGTTACCTCGAGGTAACTGTCAGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-627s21c1
Sequence:CCGGCAATAAGTGCATCAAAGATTACTCGAGTAATCTTTGATGCACTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207422.2-783s21c1
Sequence:CCGGATGGTTGCTCTGCGGACTACTCTCGAGAGTAGTCCGCAGAGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207422.2-585s21c1
Sequence:CCGGGAATCATCACCTGCAAGAAACCTCGAGGTTTCTTGCAGGTGATGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks