EMAIL THIS PAGE TO A FRIEND

FLJ44674

30 Gene Product Result for
Species: Human FLJ44674(400535)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207449 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041153 Rosetta Predictions human pricing
XR_041154 Rosetta Predictions human pricing
XR_041155 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525108 predicted 285
2 SASI_Hs02_00525109 predicted 394
3 SASI_Hs02_00525110 predicted 348
4 SASI_Hs02_00525111 predicted 225
5 SASI_Hs02_00525112 predicted 222
6 SASI_Hs02_00525113 predicted 390
7 SASI_Hs02_00525114 predicted 241
8 SASI_Hs02_00525115 predicted 297
9 SASI_Hs02_00525116 predicted 380
10 SASI_Hs02_00525117 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525118 predicted 292
2 SASI_Hs02_00525119 predicted 391
3 SASI_Hs02_00525120 predicted 349
4 SASI_Hs02_00525121 predicted 220
5 SASI_Hs02_00525122 predicted 223
6 SASI_Hs02_00525123 predicted 385
7 SASI_Hs02_00525124 predicted 234
8 SASI_Hs02_00525125 predicted 298
9 SASI_Hs02_00525126 predicted 381
10 SASI_Hs02_00525127 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525128 predicted 289
2 SASI_Hs02_00525129 predicted 395
3 SASI_Hs02_00525130 predicted 346
4 SASI_Hs02_00525131 predicted 226
5 SASI_Hs02_00525132 predicted 230
6 SASI_Hs02_00525133 predicted 394
7 SASI_Hs02_00525134 predicted 241
8 SASI_Hs02_00525135 predicted 298
9 SASI_Hs02_00525136 predicted 380
10 SASI_Hs02_00525137 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378594
FLJ44674 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000137522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4582s1c1
Sequence:CCGGGCAAGCCACATGGAAATGGATCTCGAGATCCATTTCCATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5386s1c1
Sequence:CCGGGCTGCTGTCTGCAAGTTTGTTCTCGAGAACAAACTTGCAGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5711s1c1
Sequence:CCGGCTGAGGTTAAATGAGGTTGTACTCGAGTACAACCTCATTTAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4737s1c1
Sequence:CCGGGATCGCATTTGAATGGGTTTACTCGAGTAAACCCATTCAAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378594
FLJ44674 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000137522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4582s1c1
Sequence:CCGGGCAAGCCACATGGAAATGGATCTCGAGATCCATTTCCATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5386s1c1
Sequence:CCGGGCTGCTGTCTGCAAGTTTGTTCTCGAGAACAAACTTGCAGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5711s1c1
Sequence:CCGGCTGAGGTTAAATGAGGTTGTACTCGAGTACAACCTCATTTAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4737s1c1
Sequence:CCGGGATCGCATTTGAATGGGTTTACTCGAGTAAACCCATTCAAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378594
FLJ44674 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000137522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4582s1c1
Sequence:CCGGGCAAGCCACATGGAAATGGATCTCGAGATCCATTTCCATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5386s1c1
Sequence:CCGGGCTGCTGTCTGCAAGTTTGTTCTCGAGAACAAACTTGCAGACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378594.1-5711s1c1
Sequence:CCGGCTGAGGTTAAATGAGGTTGTACTCGAGTACAACCTCATTTAACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378594.1-4737s1c1
Sequence:CCGGGATCGCATTTGAATGGGTTTACTCGAGTAAACCCATTCAAATGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207449
FLJ44674 MISSION shRNA Bacterial Glycerol Stock
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000168092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207449.1-5185s1c1
Sequence:CCGGCAAGGAGTTCTGAGTTTCCTTCTCGAGAAGGAAACTCAGAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207449
FLJ44674 MISSION shRNA shRNA Plasmid DNA
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000168092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207449.1-5185s1c1
Sequence:CCGGCAAGGAGTTCTGAGTTTCCTTCTCGAGAAGGAAACTCAGAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207449
FLJ44674 MISSION shRNA Lentiviral Transduction Particles
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000168092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207449.1-5185s1c1
Sequence:CCGGCAAGGAGTTCTGAGTTTCCTTCTCGAGAAGGAAACTCAGAACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks