EMAIL THIS PAGE TO A FRIEND

FLJ44790

Species: Human FLJ44790(400850)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001691 Rosetta Predictions human pricing
XR_041637 Rosetta Predictions human pricing
XR_041638 Rosetta Predictions human pricing
XR_041639 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132940 predicted 1449
2 SASI_Hs01_00132941 predicted 1162
3 SASI_Hs01_00132942 predicted 1310
4 SASI_Hs01_00132943 predicted 1542
5 SASI_Hs01_00132944 predicted 1750
6 SASI_Hs01_00132945 predicted 1488
7 SASI_Hs01_00132946 predicted 1452
8 SASI_Hs01_00132947 predicted 1645
9 SASI_Hs01_00132948 predicted 1654
10 SASI_Hs01_00132949 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529119 predicted 294
2 SASI_Hs02_00529120 predicted 290
3 SASI_Hs02_00529121 predicted 284
4 SASI_Hs02_00529122 predicted 284
5 SASI_Hs02_00529123 predicted 292
6 SASI_Hs02_00529124 predicted 376
7 SASI_Hs02_00529125 predicted 356
8 SASI_Hs02_00529126 predicted 267
9 SASI_Hs02_00529127 predicted 293
10 SASI_Hs02_00529128 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529129 predicted 292
2 SASI_Hs02_00529130 predicted 297
3 SASI_Hs02_00529131 predicted 283
4 SASI_Hs02_00529132 predicted 285
5 SASI_Hs02_00529133 predicted 288
6 SASI_Hs02_00529134 predicted 374
7 SASI_Hs02_00529135 predicted 348
8 SASI_Hs02_00529136 predicted 265
9 SASI_Hs02_00529137 predicted 296
10 SASI_Hs02_00529138 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529139 predicted 294
2 SASI_Hs02_00529140 predicted 294
3 SASI_Hs02_00529141 predicted 277
4 SASI_Hs02_00529142 predicted 277
5 SASI_Hs02_00529143 predicted 290
6 SASI_Hs02_00529144 predicted 371
7 SASI_Hs02_00529145 predicted 347
8 SASI_Hs02_00529146 predicted 262
9 SASI_Hs02_00529147 predicted 297
10 SASI_Hs02_00529148 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001691
FLJ44790 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2947s1c1
Sequence:CCGGGCTCAGTCTTCTCATCTGTAACTCGAGTTACAGATGAGAAGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1172s1c1
Sequence:CCGGCCGCAGCAAGTTAAATCTAACCTCGAGGTTAGATTTAACTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1169s1c1
Sequence:CCGGCTCCCGCAGCAAGTTAAATCTCTCGAGAGATTTAACTTGCTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2333s1c1
Sequence:CCGGGCAGACCCAGATAAAGAGATACTCGAGTATCTCTTTATCTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001691
FLJ44790 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2947s1c1
Sequence:CCGGGCTCAGTCTTCTCATCTGTAACTCGAGTTACAGATGAGAAGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1172s1c1
Sequence:CCGGCCGCAGCAAGTTAAATCTAACCTCGAGGTTAGATTTAACTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1169s1c1
Sequence:CCGGCTCCCGCAGCAAGTTAAATCTCTCGAGAGATTTAACTTGCTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2333s1c1
Sequence:CCGGGCAGACCCAGATAAAGAGATACTCGAGTATCTCTTTATCTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001691
FLJ44790 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168549    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2947s1c1
Sequence:CCGGGCTCAGTCTTCTCATCTGTAACTCGAGTTACAGATGAGAAGACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1172s1c1
Sequence:CCGGCCGCAGCAAGTTAAATCTAACCTCGAGGTTAGATTTAACTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001691.1-1169s1c1
Sequence:CCGGCTCCCGCAGCAAGTTAAATCTCTCGAGAGATTTAACTTGCTGCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001691.1-2333s1c1
Sequence:CCGGGCAGACCCAGATAAAGAGATACTCGAGTATCTCTTTATCTGGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks