EMAIL THIS PAGE TO A FRIEND

FLJ44881

40 Gene Product Result for
Species: Human FLJ44881(400661)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207461 Rosetta Predictions human pricing
XR_039918 Rosetta Predictions human pricing
XR_039919 Rosetta Predictions human pricing
XR_039920 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172203 predicted 757
2 SASI_Hs01_00172204 predicted 835
3 SASI_Hs01_00172205 predicted 379
4 SASI_Hs01_00172206 predicted 735
5 SASI_Hs01_00172207 predicted 380
6 SASI_Hs01_00172208 predicted 261
7 SASI_Hs01_00172209 predicted 737
8 SASI_Hs01_00172210 predicted 421
9 SASI_Hs01_00172211 predicted 520
10 SASI_Hs01_00172212 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514243 predicted 371
2 SASI_Hs02_00514244 predicted 723
3 SASI_Hs02_00514245 predicted 380
4 SASI_Hs02_00514246 predicted 258
5 SASI_Hs02_00514247 predicted 735
6 SASI_Hs02_00514248 predicted 417
7 SASI_Hs02_00514249 predicted 522
8 SASI_Hs02_00514250 predicted 550
9 SASI_Hs02_00514251 predicted 260
10 SASI_Hs02_00514252 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514253 predicted 178
2 SASI_Hs02_00514254 predicted 174
3 SASI_Hs02_00514255 predicted 328
4 SASI_Hs02_00514256 predicted 222
5 SASI_Hs02_00514257 predicted 223
6 SASI_Hs02_00514258 predicted 100
7 SASI_Hs02_00514259 predicted 257
8 SASI_Hs02_00514260 predicted 106
9 SASI_Hs02_00514261 predicted 131
10 SASI_Hs02_00514262 predicted 70
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514263 predicted 177
2 SASI_Hs02_00514264 predicted 177
3 SASI_Hs02_00514265 predicted 325
4 SASI_Hs02_00514266 predicted 220
5 SASI_Hs02_00514267 predicted 219
6 SASI_Hs02_00514268 predicted 96
7 SASI_Hs02_00514269 predicted 253
8 SASI_Hs02_00514270 predicted 103
9 SASI_Hs02_00514271 predicted 136
10 SASI_Hs02_00514272 predicted 74
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207461
FLJ44881 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-402s1c1
Sequence:CCGGCATGAACAACGCAAACGGAATCTCGAGATTCCGTTTGCGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-387s1c1
Sequence:CCGGCGAGGTGTTGGAATACATGAACTCGAGTTCATGTATTCCAACACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-441s1c1
Sequence:CCGGGTCTTTAATCATTGGCTGCCTCTCGAGAGGCAGCCAATGATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-183s1c1
Sequence:CCGGGAAACCAACAAGAGCTCCTTCCTCGAGGAAGGAGCTCTTGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207461.1-1922s1c1
Sequence:CCGGGCAAGTTTCAACATCAGGAAACTCGAGTTTCCTGATGTTGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-417s1c1
Sequence:CCGGCGGAATATCTCGTCTCTCATTCTCGAGAATGAGAGACGAGATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207461
FLJ44881 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-402s1c1
Sequence:CCGGCATGAACAACGCAAACGGAATCTCGAGATTCCGTTTGCGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-387s1c1
Sequence:CCGGCGAGGTGTTGGAATACATGAACTCGAGTTCATGTATTCCAACACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-441s1c1
Sequence:CCGGGTCTTTAATCATTGGCTGCCTCTCGAGAGGCAGCCAATGATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-183s1c1
Sequence:CCGGGAAACCAACAAGAGCTCCTTCCTCGAGGAAGGAGCTCTTGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207461.1-1922s1c1
Sequence:CCGGGCAAGTTTCAACATCAGGAAACTCGAGTTTCCTGATGTTGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-417s1c1
Sequence:CCGGCGGAATATCTCGTCTCTCATTCTCGAGAATGAGAGACGAGATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207461
FLJ44881 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-402s1c1
Sequence:CCGGCATGAACAACGCAAACGGAATCTCGAGATTCCGTTTGCGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-387s1c1
Sequence:CCGGCGAGGTGTTGGAATACATGAACTCGAGTTCATGTATTCCAACACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207461.1-441s1c1
Sequence:CCGGGTCTTTAATCATTGGCTGCCTCTCGAGAGGCAGCCAATGATTAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-183s1c1
Sequence:CCGGGAAACCAACAAGAGCTCCTTCCTCGAGGAAGGAGCTCTTGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207461.1-1922s1c1
Sequence:CCGGGCAAGTTTCAACATCAGGAAACTCGAGTTTCCTGATGTTGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207461.1-417s1c1
Sequence:CCGGCGGAATATCTCGTCTCTCATTCTCGAGAATGAGAGACGAGATATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks