EMAIL THIS PAGE TO A FRIEND

FLJ45079

Species: Human FLJ45079(400624)
Gene ID:
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001685 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001685 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200827 predicted 2239
2 SASI_Hs02_00303883 predicted 1449
3 SASI_Hs01_00200829 predicted 2908
4 SASI_Hs01_00200832 predicted 3864
5 SASI_Hs01_00200833 predicted 4505
6 SASI_Hs01_00200834 predicted 3742
7 SASI_Hs01_00200836 predicted 3802
8 SASI_Hs02_00303884 predicted 3737
9 SASI_Hs02_00303885 predicted 3443
10 SASI_Hs02_00303886 predicted 3265
11 SASI_Hs01_00200828 predicted 3882
12 SASI_Hs01_00200830 predicted 3749
13 SASI_Hs01_00200831 predicted 3398
14 SASI_Hs01_00200835 predicted 3401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001685
FLJ45079 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1340s21c1
Sequence:CCGGTTGAACACATGTGCACATATACTCGAGTATATGTGCACATGTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001685.1-3743s21c1
Sequence:CCGGTGCTAACTTTCCCACTATTAACTCGAGTTAATAGTGGGAAAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1602s21c1
Sequence:GTACCGGACAGTGCACACTTACACATTTCTCGAGAAATGTGTAAGTGTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1567s21c1
Sequence:CCGGCACTTGTACACTGACACATATCTCGAGATATGTGTCAGTGTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1392s21c1
Sequence:CCGGCTGTGCACTAGCACCCATTTGCTCGAGCAAATGGGTGCTAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001685
FLJ45079 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1340s21c1
Sequence:CCGGTTGAACACATGTGCACATATACTCGAGTATATGTGCACATGTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001685.1-3743s21c1
Sequence:CCGGTGCTAACTTTCCCACTATTAACTCGAGTTAATAGTGGGAAAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1602s21c1
Sequence:GTACCGGACAGTGCACACTTACACATTTCTCGAGAAATGTGTAAGTGTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1567s21c1
Sequence:CCGGCACTTGTACACTGACACATATCTCGAGATATGTGTCAGTGTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1392s21c1
Sequence:CCGGCTGTGCACTAGCACCCATTTGCTCGAGCAAATGGGTGCTAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001685
FLJ45079 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1340s21c1
Sequence:CCGGTTGAACACATGTGCACATATACTCGAGTATATGTGCACATGTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001685.1-3743s21c1
Sequence:CCGGTGCTAACTTTCCCACTATTAACTCGAGTTAATAGTGGGAAAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1602s21c1
Sequence:GTACCGGACAGTGCACACTTACACATTTCTCGAGAAATGTGTAAGTGTGCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1567s21c1
Sequence:CCGGCACTTGTACACTGACACATATCTCGAGATATGTGTCAGTGTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001685.1-1392s21c1
Sequence:CCGGCTGTGCACTAGCACCCATTTGCTCGAGCAAATGGGTGCTAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks