EMAIL THIS PAGE TO A FRIEND

FLJ45139

12 Gene Product Result for
Species: Human FLJ45139(400867)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001692 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190427 predicted 2355
2 SASI_Hs01_00190428 predicted 2368
3 SASI_Hs01_00190429 predicted 2382
4 SASI_Hs01_00190430 predicted 2365
5 SASI_Hs01_00190431 predicted 2384
6 SASI_Hs01_00190432 predicted 2359
7 SASI_Hs01_00190433 predicted 2372
8 SASI_Hs01_00190434 predicted 2376
9 SASI_Hs01_00190435 predicted 2373
10 SASI_Hs02_00303887 predicted 2355
11 SASI_Hs01_00190436 predicted 2373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001692
FLJ45139 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3585s1c1
Sequence:CCGGCCGATCTATATGAAGCTCAATCTCGAGATTGAGCTTCATATAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3141s1c1
Sequence:CCGGGCATCCATTAGAAAGGCTAAACTCGAGTTTAGCCTTTCTAATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3599s1c1
Sequence:CCGGGCTCAATAACACATGGTACTACTCGAGTAGTACCATGTGTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001692.1-2302s1c1
Sequence:CCGGCTAGAAAGCATTTGGCTAAGACTCGAGTCTTAGCCAAATGCTTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001692.1-2586s1c1
Sequence:CCGGCAAGAGTGATCTCATCTCTTACTCGAGTAAGAGATGAGATCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001692
FLJ45139 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3585s1c1
Sequence:CCGGCCGATCTATATGAAGCTCAATCTCGAGATTGAGCTTCATATAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3141s1c1
Sequence:CCGGGCATCCATTAGAAAGGCTAAACTCGAGTTTAGCCTTTCTAATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3599s1c1
Sequence:CCGGGCTCAATAACACATGGTACTACTCGAGTAGTACCATGTGTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001692.1-2302s1c1
Sequence:CCGGCTAGAAAGCATTTGGCTAAGACTCGAGTCTTAGCCAAATGCTTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001692.1-2586s1c1
Sequence:CCGGCAAGAGTGATCTCATCTCTTACTCGAGTAAGAGATGAGATCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001692
FLJ45139 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3585s1c1
Sequence:CCGGCCGATCTATATGAAGCTCAATCTCGAGATTGAGCTTCATATAGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3141s1c1
Sequence:CCGGGCATCCATTAGAAAGGCTAAACTCGAGTTTAGCCTTTCTAATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001692.1-3599s1c1
Sequence:CCGGGCTCAATAACACATGGTACTACTCGAGTAGTACCATGTGTTATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001692.1-2302s1c1
Sequence:CCGGCTAGAAAGCATTTGGCTAAGACTCGAGTCTTAGCCAAATGCTTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001692.1-2586s1c1
Sequence:CCGGCAAGAGTGATCTCATCTCTTACTCGAGTAAGAGATGAGATCACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks