EMAIL THIS PAGE TO A FRIEND

FLJ45248

10 Gene Product Result for
Species: Human FLJ45248(401472)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207505 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207505 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204638 predicted 617
2 SASI_Hs01_00204639 predicted 606
3 SASI_Hs01_00204640 predicted 624
4 SASI_Hs01_00204641 predicted 627
5 SASI_Hs01_00204642 predicted 625
6 SASI_Hs01_00204643 predicted 591
7 SASI_Hs01_00204644 predicted 579
8 SASI_Hs01_00204645 predicted 615
9 SASI_Hs01_00204646 predicted 581
10 SASI_Hs01_00204647 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207505
FLJ45248 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-2388s1c1
Sequence:CCGGCAGTATTTATTGGAGGGTATTCTCGAGAATACCCTCCAATAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-1790s1c1
Sequence:CCGGCCTGGATCTACAGGGTTCATACTCGAGTATGAACCCTGTAGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207505
FLJ45248 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-2388s1c1
Sequence:CCGGCAGTATTTATTGGAGGGTATTCTCGAGAATACCCTCCAATAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-1790s1c1
Sequence:CCGGCCTGGATCTACAGGGTTCATACTCGAGTATGAACCCTGTAGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207505
FLJ45248 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-2388s1c1
Sequence:CCGGCAGTATTTATTGGAGGGTATTCTCGAGAATACCCTCCAATAAATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172502    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207505.1-1790s1c1
Sequence:CCGGCCTGGATCTACAGGGTTCATACTCGAGTATGAACCCTGTAGATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks