EMAIL THIS PAGE TO A FRIEND

FLJ45256

40 Gene Product Result for
Species: Human FLJ45256(400511)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207448 Rosetta Predictions human pricing
XR_041134 Rosetta Predictions human pricing
XR_041135 Rosetta Predictions human pricing
XR_041136 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081134 predicted 1549
2 SASI_Hs01_00081135 predicted 1539
3 SASI_Hs01_00081136 predicted 1566
4 SASI_Hs01_00081137 predicted 1587
5 SASI_Hs01_00081138 predicted 1553
6 SASI_Hs01_00081139 predicted 1415
7 SASI_Hs01_00081140 predicted 1564
8 SASI_Hs01_00081141 predicted 1519
9 SASI_Hs01_00081142 predicted 1419
10 SASI_Hs01_00081143 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524945 predicted 452
2 SASI_Hs02_00524946 predicted 484
3 SASI_Hs02_00524947 predicted 418
4 SASI_Hs02_00524948 predicted 286
5 SASI_Hs02_00524949 predicted 347
6 SASI_Hs02_00524950 predicted 461
7 SASI_Hs02_00524951 predicted 566
8 SASI_Hs02_00524952 predicted 472
9 SASI_Hs02_00524953 predicted 351
10 SASI_Hs02_00524954 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524955 predicted 450
2 SASI_Hs02_00524956 predicted 486
3 SASI_Hs02_00524957 predicted 410
4 SASI_Hs02_00524958 predicted 286
5 SASI_Hs02_00524959 predicted 350
6 SASI_Hs02_00524960 predicted 457
7 SASI_Hs02_00524961 predicted 569
8 SASI_Hs02_00524962 predicted 478
9 SASI_Hs02_00524963 predicted 349
10 SASI_Hs02_00524964 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524965 predicted 450
2 SASI_Hs02_00524966 predicted 485
3 SASI_Hs02_00524967 predicted 410
4 SASI_Hs02_00524968 predicted 277
5 SASI_Hs02_00524969 predicted 347
6 SASI_Hs02_00524970 predicted 458
7 SASI_Hs02_00524971 predicted 568
8 SASI_Hs02_00524972 predicted 476
9 SASI_Hs02_00524973 predicted 348
10 SASI_Hs02_00524974 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378571
FLJ45256 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-399s1c1
Sequence:CCGGCAGGATAACTGCTAACGGCTTCTCGAGAAGCCGTTAGCAGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-308s1c1
Sequence:CCGGCCTTCATTTACAGAAAGGGTTCTCGAGAACCCTTTCTGTAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-402s1c1
Sequence:CCGGGATAACTGCTAACGGCTTAAACTCGAGTTTAAGCCGTTAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378571.1-1528s1c1
Sequence:CCGGGCCAGAATTGAAGAACCATTTCTCGAGAAATGGTTCTTCAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-169s1c1
Sequence:CCGGGATGTTAGAATCTGGCTGCAACTCGAGTTGCAGCCAGATTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378571
FLJ45256 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-399s1c1
Sequence:CCGGCAGGATAACTGCTAACGGCTTCTCGAGAAGCCGTTAGCAGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-308s1c1
Sequence:CCGGCCTTCATTTACAGAAAGGGTTCTCGAGAACCCTTTCTGTAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-402s1c1
Sequence:CCGGGATAACTGCTAACGGCTTAAACTCGAGTTTAAGCCGTTAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378571.1-1528s1c1
Sequence:CCGGGCCAGAATTGAAGAACCATTTCTCGAGAAATGGTTCTTCAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-169s1c1
Sequence:CCGGGATGTTAGAATCTGGCTGCAACTCGAGTTGCAGCCAGATTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378571
FLJ45256 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-399s1c1
Sequence:CCGGCAGGATAACTGCTAACGGCTTCTCGAGAAGCCGTTAGCAGTTATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-308s1c1
Sequence:CCGGCCTTCATTTACAGAAAGGGTTCTCGAGAACCCTTTCTGTAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-402s1c1
Sequence:CCGGGATAACTGCTAACGGCTTAAACTCGAGTTTAAGCCGTTAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378571.1-1528s1c1
Sequence:CCGGGCCAGAATTGAAGAACCATTTCTCGAGAAATGGTTCTTCAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378571.1-169s1c1
Sequence:CCGGGATGTTAGAATCTGGCTGCAACTCGAGTTGCAGCCAGATTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks