EMAIL THIS PAGE TO A FRIEND

FLJ45684

10 Gene Product Result for
Species: Human FLJ45684(400666)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207462 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025517 predicted 731
2 SASI_Hs01_00025518 predicted 963
3 SASI_Hs01_00025519 predicted 643
4 SASI_Hs01_00025520 predicted 1142
5 SASI_Hs01_00025521 predicted 946
6 SASI_Hs01_00025522 predicted 805
7 SASI_Hs01_00025523 predicted 1059
8 SASI_Hs01_00025524 predicted 914
9 SASI_Hs01_00025525 predicted 630
10 SASI_Hs01_00025526 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207462
FLJ45684 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207462.1-358s1c1
Sequence:CCGGCCTACCTGTTCTCCAAAGACTCTCGAGAGTCTTTGGAGAACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207462.1-1420s1c1
Sequence:CCGGGAAGCACAGTTTGCAACAGTTCTCGAGAACTGTTGCAAACTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207462
FLJ45684 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207462.1-358s1c1
Sequence:CCGGCCTACCTGTTCTCCAAAGACTCTCGAGAGTCTTTGGAGAACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207462.1-1420s1c1
Sequence:CCGGGAAGCACAGTTTGCAACAGTTCTCGAGAACTGTTGCAAACTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207462
FLJ45684 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207462.1-358s1c1
Sequence:CCGGCCTACCTGTTCTCCAAAGACTCTCGAGAGTCTTTGGAGAACAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207462.1-1420s1c1
Sequence:CCGGGAAGCACAGTTTGCAACAGTTCTCGAGAACTGTTGCAAACTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks