EMAIL THIS PAGE TO A FRIEND

FLJ45721

40 Gene Product Result for
Species: Human FLJ45721(401123)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207490 Rosetta Predictions human pricing
XR_041599 Rosetta Predictions human pricing
XR_041600 Rosetta Predictions human pricing
XR_041601 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059934 predicted 2207
2 SASI_Hs01_00059935 predicted 2267
3 SASI_Hs01_00059936 predicted 2258
4 SASI_Hs01_00059937 predicted 2239
5 SASI_Hs01_00059938 predicted 2189
6 SASI_Hs01_00059939 predicted 2245
7 SASI_Hs01_00059940 predicted 2228
8 SASI_Hs01_00059941 predicted 2216
9 SASI_Hs01_00059942 predicted 2260
10 SASI_Hs01_00059943 predicted 2233
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528742 predicted 274
2 SASI_Hs02_00528743 predicted 336
3 SASI_Hs02_00528744 predicted 335
4 SASI_Hs02_00528745 predicted 301
5 SASI_Hs02_00528746 predicted 252
6 SASI_Hs02_00528747 predicted 301
7 SASI_Hs02_00528748 predicted 292
8 SASI_Hs02_00528749 predicted 275
9 SASI_Hs02_00528750 predicted 328
10 SASI_Hs02_00528751 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528752 predicted 276
2 SASI_Hs02_00528753 predicted 330
3 SASI_Hs02_00528754 predicted 336
4 SASI_Hs02_00528755 predicted 306
5 SASI_Hs02_00528756 predicted 309
6 SASI_Hs02_00528757 predicted 294
7 SASI_Hs02_00528758 predicted 248
8 SASI_Hs02_00528759 predicted 280
9 SASI_Hs02_00528760 predicted 335
10 SASI_Hs02_00528761 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528762 predicted 278
2 SASI_Hs02_00528763 predicted 331
3 SASI_Hs02_00528764 predicted 332
4 SASI_Hs02_00528765 predicted 297
5 SASI_Hs02_00528766 predicted 249
6 SASI_Hs02_00528767 predicted 304
7 SASI_Hs02_00528768 predicted 287
8 SASI_Hs02_00528769 predicted 283
9 SASI_Hs02_00528770 predicted 328
10 SASI_Hs02_00528771 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207490
FLJ45721 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-1971s1c1
Sequence:CCGGCACACACACACACTCAGTCTTCTCGAGAAGACTGAGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2004s1c1
Sequence:CCGGCGTAACTGTATTTCAATGGATCTCGAGATCCATTGAAATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2238s1c1
Sequence:CCGGCCCTGATTCCATCTCTAGATACTCGAGTATCTAGAGATGGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1995s1c1
Sequence:CCGGGAGCAGCAACGTAACTGTATTCTCGAGAATACAGTTACGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2357s1c1
Sequence:CCGGGAGAAACACAGCCTAGTGTTACTCGAGTAACACTAGGCTGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2111s1c1
Sequence:CCGGCCACACAGAACACATGTCAAACTCGAGTTTGACATGTGTTCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1987s1c1
Sequence:CCGGGTCTTTATGAGCAGCAACGTACTCGAGTACGTTGCTGCTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2297s1c1
Sequence:CCGGGCAGAAAGTCTGCCTTGCTTACTCGAGTAAGCAAGGCAGACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207490
FLJ45721 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-1971s1c1
Sequence:CCGGCACACACACACACTCAGTCTTCTCGAGAAGACTGAGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2004s1c1
Sequence:CCGGCGTAACTGTATTTCAATGGATCTCGAGATCCATTGAAATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2238s1c1
Sequence:CCGGCCCTGATTCCATCTCTAGATACTCGAGTATCTAGAGATGGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1995s1c1
Sequence:CCGGGAGCAGCAACGTAACTGTATTCTCGAGAATACAGTTACGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2357s1c1
Sequence:CCGGGAGAAACACAGCCTAGTGTTACTCGAGTAACACTAGGCTGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2111s1c1
Sequence:CCGGCCACACAGAACACATGTCAAACTCGAGTTTGACATGTGTTCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1987s1c1
Sequence:CCGGGTCTTTATGAGCAGCAACGTACTCGAGTACGTTGCTGCTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2297s1c1
Sequence:CCGGGCAGAAAGTCTGCCTTGCTTACTCGAGTAAGCAAGGCAGACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207490
FLJ45721 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-1971s1c1
Sequence:CCGGCACACACACACACTCAGTCTTCTCGAGAAGACTGAGTGTGTGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2004s1c1
Sequence:CCGGCGTAACTGTATTTCAATGGATCTCGAGATCCATTGAAATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2238s1c1
Sequence:CCGGCCCTGATTCCATCTCTAGATACTCGAGTATCTAGAGATGGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1995s1c1
Sequence:CCGGGAGCAGCAACGTAACTGTATTCTCGAGAATACAGTTACGTTGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2357s1c1
Sequence:CCGGGAGAAACACAGCCTAGTGTTACTCGAGTAACACTAGGCTGTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207490.1-2111s1c1
Sequence:CCGGCCACACAGAACACATGTCAAACTCGAGTTTGACATGTGTTCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-1987s1c1
Sequence:CCGGGTCTTTATGAGCAGCAACGTACTCGAGTACGTTGCTGCTCATAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207490.1-2297s1c1
Sequence:CCGGGCAGAAAGTCTGCCTTGCTTACTCGAGTAAGCAAGGCAGACTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks