EMAIL THIS PAGE TO A FRIEND

FLJ45964

40 Gene Product Result for
Species: Human FLJ45964(401040)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207483 Rosetta Predictions human pricing
XR_041562 Rosetta Predictions human pricing
XR_041563 Rosetta Predictions human pricing
XR_041564 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226520 predicted 722
2 SASI_Hs01_00226521 predicted 1039
3 SASI_Hs01_00226522 predicted 680
4 SASI_Hs01_00226523 predicted 648
5 SASI_Hs01_00226524 predicted 647
6 SASI_Hs01_00226525 predicted 811
7 SASI_Hs01_00226526 predicted 1196
8 SASI_Hs01_00226527 predicted 781
9 SASI_Hs01_00226528 predicted 1006
10 SASI_Hs01_00226529 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528391 predicted 553
2 SASI_Hs02_00528392 predicted 674
3 SASI_Hs02_00528393 predicted 555
4 SASI_Hs02_00528394 predicted 602
5 SASI_Hs02_00528395 predicted 651
6 SASI_Hs02_00528396 predicted 642
7 SASI_Hs02_00528397 predicted 578
8 SASI_Hs02_00528398 predicted 546
9 SASI_Hs02_00528399 predicted 490
10 SASI_Hs02_00528400 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528401 predicted 555
2 SASI_Hs02_00528402 predicted 673
3 SASI_Hs02_00528403 predicted 555
4 SASI_Hs02_00528404 predicted 607
5 SASI_Hs02_00528405 predicted 648
6 SASI_Hs02_00528406 predicted 643
7 SASI_Hs02_00528407 predicted 578
8 SASI_Hs02_00528408 predicted 541
9 SASI_Hs02_00528409 predicted 487
10 SASI_Hs02_00528410 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528411 predicted 552
2 SASI_Hs02_00528412 predicted 667
3 SASI_Hs02_00528413 predicted 553
4 SASI_Hs02_00528414 predicted 599
5 SASI_Hs02_00528415 predicted 649
6 SASI_Hs02_00528416 predicted 641
7 SASI_Hs02_00528417 predicted 577
8 SASI_Hs02_00528418 predicted 548
9 SASI_Hs02_00528419 predicted 481
10 SASI_Hs02_00528420 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376191
FLJ45964 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-403s1c1
Sequence:CCGGCTTCACTGAATCCACCATCGTCTCGAGACGATGGTGGATTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1842s1c1
Sequence:CCGGGCAAAGTTTCGACACCCACTTCTCGAGAAGTGGGTGTCGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-628s1c1
Sequence:CCGGCTTTCCTGAAGTTGGACAGTTCTCGAGAACTGTCCAACTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-590s1c1
Sequence:CCGGCAAAGCTAAGACTTTCACCTTCTCGAGAAGGTGAAAGTCTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-601s1c1
Sequence:CCGGCTTTCACCTTGGCATTTGTTACTCGAGTAACAAATGCCAAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-3173s1c1
Sequence:CCGGGCATTGTTGAATCATGGAGAACTCGAGTTCTCCATGATTCAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-676s1c1
Sequence:CCGGCCATAGAATTGTCTTCTGGAACTCGAGTTCCAGAAGACAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-594s1c1
Sequence:CCGGGCTAAGACTTTCACCTTGGCACTCGAGTGCCAAGGTGAAAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-638s1c1
Sequence:CCGGGTTGGACAGTTTGGCCATGTTCTCGAGAACATGGCCAAACTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1830s1c1
Sequence:CCGGCCACGTGTCATGGCAAAGTTTCTCGAGAAACTTTGCCATGACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376191
FLJ45964 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-403s1c1
Sequence:CCGGCTTCACTGAATCCACCATCGTCTCGAGACGATGGTGGATTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1842s1c1
Sequence:CCGGGCAAAGTTTCGACACCCACTTCTCGAGAAGTGGGTGTCGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-628s1c1
Sequence:CCGGCTTTCCTGAAGTTGGACAGTTCTCGAGAACTGTCCAACTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-590s1c1
Sequence:CCGGCAAAGCTAAGACTTTCACCTTCTCGAGAAGGTGAAAGTCTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-601s1c1
Sequence:CCGGCTTTCACCTTGGCATTTGTTACTCGAGTAACAAATGCCAAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-3173s1c1
Sequence:CCGGGCATTGTTGAATCATGGAGAACTCGAGTTCTCCATGATTCAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-676s1c1
Sequence:CCGGCCATAGAATTGTCTTCTGGAACTCGAGTTCCAGAAGACAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-594s1c1
Sequence:CCGGGCTAAGACTTTCACCTTGGCACTCGAGTGCCAAGGTGAAAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-638s1c1
Sequence:CCGGGTTGGACAGTTTGGCCATGTTCTCGAGAACATGGCCAAACTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1830s1c1
Sequence:CCGGCCACGTGTCATGGCAAAGTTTCTCGAGAAACTTTGCCATGACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376191
FLJ45964 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-403s1c1
Sequence:CCGGCTTCACTGAATCCACCATCGTCTCGAGACGATGGTGGATTCAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1842s1c1
Sequence:CCGGGCAAAGTTTCGACACCCACTTCTCGAGAAGTGGGTGTCGAAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-628s1c1
Sequence:CCGGCTTTCCTGAAGTTGGACAGTTCTCGAGAACTGTCCAACTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-590s1c1
Sequence:CCGGCAAAGCTAAGACTTTCACCTTCTCGAGAAGGTGAAAGTCTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-601s1c1
Sequence:CCGGCTTTCACCTTGGCATTTGTTACTCGAGTAACAAATGCCAAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-3173s1c1
Sequence:CCGGGCATTGTTGAATCATGGAGAACTCGAGTTCTCCATGATTCAACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376191.1-676s1c1
Sequence:CCGGCCATAGAATTGTCTTCTGGAACTCGAGTTCCAGAAGACAATTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-594s1c1
Sequence:CCGGGCTAAGACTTTCACCTTGGCACTCGAGTGCCAAGGTGAAAGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376191.1-638s1c1
Sequence:CCGGGTTGGACAGTTTGGCCATGTTCTCGAGAACATGGCCAAACTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376191.1-1830s1c1
Sequence:CCGGCCACGTGTCATGGCAAAGTTTCTCGAGAAACTTTGCCATGACACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks