EMAIL THIS PAGE TO A FRIEND

FLJ45974

50 Gene Product Result for
Species: Human FLJ45974(401337)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001707 Rosetta Predictions human pricing
XR_040790 Rosetta Predictions human pricing
XR_040791 Rosetta Predictions human pricing
XR_040792 Rosetta Predictions human pricing
XR_040793 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247085 predicted 358
2 SASI_Hs01_00247086 predicted 395
3 SASI_Hs01_00247087 predicted 437
4 SASI_Hs01_00247088 predicted 488
5 SASI_Hs01_00247089 predicted 520
6 SASI_Hs01_00247090 predicted 104
7 SASI_Hs01_00247091 predicted 549
8 SASI_Hs01_00247092 predicted 560
9 SASI_Hs01_00247093 predicted 346
10 SASI_Hs01_00247094 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521961 predicted 350
2 SASI_Hs02_00521962 predicted 383
3 SASI_Hs02_00521963 predicted 475
4 SASI_Hs02_00521964 predicted 505
5 SASI_Hs02_00521965 predicted 349
6 SASI_Hs02_00521966 predicted 543
7 SASI_Hs02_00521967 predicted 551
8 SASI_Hs02_00521968 predicted 333
9 SASI_Hs02_00521969 predicted 223
10 SASI_Hs02_00521970 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521971 predicted 344
2 SASI_Hs02_00521972 predicted 379
3 SASI_Hs02_00521973 predicted 480
4 SASI_Hs02_00521974 predicted 508
5 SASI_Hs02_00521975 predicted 353
6 SASI_Hs02_00521976 predicted 543
7 SASI_Hs02_00521977 predicted 554
8 SASI_Hs02_00521978 predicted 335
9 SASI_Hs02_00521979 predicted 221
10 SASI_Hs02_00521980 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521981 predicted 345
2 SASI_Hs02_00521982 predicted 384
3 SASI_Hs02_00521983 predicted 482
4 SASI_Hs02_00521984 predicted 507
5 SASI_Hs02_00521985 predicted 355
6 SASI_Hs02_00521986 predicted 544
7 SASI_Hs02_00521987 predicted 551
8 SASI_Hs02_00521988 predicted 330
9 SASI_Hs02_00521989 predicted 220
10 SASI_Hs02_00521990 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521991 predicted 342
2 SASI_Hs02_00521992 predicted 385
3 SASI_Hs02_00521993 predicted 479
4 SASI_Hs02_00521994 predicted 502
5 SASI_Hs02_00521995 predicted 356
6 SASI_Hs02_00521996 predicted 537
7 SASI_Hs02_00521997 predicted 554
8 SASI_Hs02_00521998 predicted 332
9 SASI_Hs02_00521999 predicted 225
10 SASI_Hs02_00522000 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001707
FLJ45974 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-498s1c1
Sequence:CCGGCAAATCATGGAAGACTCAAGACTCGAGTCTTGAGTCTTCCATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-476s1c1
Sequence:CCGGCCGCGAAATACATGGACACTTCTCGAGAAGTGTCCATGTATTTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-464s1c1
Sequence:CCGGCACATCAGAACACCGCGAAATCTCGAGATTTCGCGGTGTTCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-336s1c1
Sequence:CCGGCCACTCTCTAACTCACACACACTCGAGTGTGTGTGAGTTAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-392s1c1
Sequence:CCGGCTCCAAGAACATTCTCATCCTCTCGAGAGGATGAGAATGTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-439s1c1
Sequence:CCGGCAGGAGTGTTGAAGAAATGTTCTCGAGAACATTTCTTCAACACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001707
FLJ45974 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-498s1c1
Sequence:CCGGCAAATCATGGAAGACTCAAGACTCGAGTCTTGAGTCTTCCATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-476s1c1
Sequence:CCGGCCGCGAAATACATGGACACTTCTCGAGAAGTGTCCATGTATTTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-464s1c1
Sequence:CCGGCACATCAGAACACCGCGAAATCTCGAGATTTCGCGGTGTTCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-336s1c1
Sequence:CCGGCCACTCTCTAACTCACACACACTCGAGTGTGTGTGAGTTAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-392s1c1
Sequence:CCGGCTCCAAGAACATTCTCATCCTCTCGAGAGGATGAGAATGTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-439s1c1
Sequence:CCGGCAGGAGTGTTGAAGAAATGTTCTCGAGAACATTTCTTCAACACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001707
FLJ45974 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-498s1c1
Sequence:CCGGCAAATCATGGAAGACTCAAGACTCGAGTCTTGAGTCTTCCATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-476s1c1
Sequence:CCGGCCGCGAAATACATGGACACTTCTCGAGAAGTGTCCATGTATTTCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-464s1c1
Sequence:CCGGCACATCAGAACACCGCGAAATCTCGAGATTTCGCGGTGTTCTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001707.1-336s1c1
Sequence:CCGGCCACTCTCTAACTCACACACACTCGAGTGTGTGTGAGTTAGAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-392s1c1
Sequence:CCGGCTCCAAGAACATTCTCATCCTCTCGAGAGGATGAGAATGTTCTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001707.1-439s1c1
Sequence:CCGGCAGGAGTGTTGAAGAAATGTTCTCGAGAACATTTCTTCAACACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376611
FLJ45974 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-360s1c1
Sequence:CCGGGAAAGAGCATACGGGAGAGATCTCGAGATCTCTCCCGTATGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-477s1c1
Sequence:CCGGCGCGAAATACATGGACACTTTCTCGAGAAAGTGTCCATGTATTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376611.1-2529s1c1
Sequence:CCGGCCTAGCTGATACAATTTCATTCTCGAGAATGAAATTGTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-389s1c1
Sequence:CCGGCCACTCCAAGAACATTCTCATCTCGAGATGAGAATGTTCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376611
FLJ45974 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-360s1c1
Sequence:CCGGGAAAGAGCATACGGGAGAGATCTCGAGATCTCTCCCGTATGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-477s1c1
Sequence:CCGGCGCGAAATACATGGACACTTTCTCGAGAAAGTGTCCATGTATTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376611.1-2529s1c1
Sequence:CCGGCCTAGCTGATACAATTTCATTCTCGAGAATGAAATTGTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-389s1c1
Sequence:CCGGCCACTCCAAGAACATTCTCATCTCGAGATGAGAATGTTCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376611
FLJ45974 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-360s1c1
Sequence:CCGGGAAAGAGCATACGGGAGAGATCTCGAGATCTCTCCCGTATGCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-477s1c1
Sequence:CCGGCGCGAAATACATGGACACTTTCTCGAGAAAGTGTCCATGTATTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376611.1-2529s1c1
Sequence:CCGGCCTAGCTGATACAATTTCATTCTCGAGAATGAAATTGTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376611.1-389s1c1
Sequence:CCGGCCACTCCAAGAACATTCTCATCTCGAGATGAGAATGTTCTTGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks