EMAIL THIS PAGE TO A FRIEND

FLJ46010

40 Gene Product Result for
Species: Human FLJ46010(401191)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001703 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001703 Rosetta Predictions human pricing
XR_040674 Rosetta Predictions human pricing
XR_040675 Rosetta Predictions human pricing
XR_040676 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207613 predicted 284
2 SASI_Hs01_00207614 predicted 361
3 SASI_Hs01_00207615 predicted 256
4 SASI_Hs01_00207616 predicted 956
5 SASI_Hs01_00207617 predicted 1314
6 SASI_Hs01_00207618 predicted 1658
7 SASI_Hs01_00207619 predicted 1815
8 SASI_Hs01_00207620 predicted 2191
9 SASI_Hs01_00207621 predicted 1655
10 SASI_Hs01_00207622 predicted 2239
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520947 predicted 169
2 SASI_Hs02_00520948 predicted 24
3 SASI_Hs02_00520949 predicted 28
4 SASI_Hs02_00520950 predicted 109
5 SASI_Hs02_00520951 predicted 192
6 SASI_Hs02_00520952 predicted 124
7 SASI_Hs02_00520953 predicted 341
8 SASI_Hs02_00520954 predicted 115
9 SASI_Hs02_00520955 predicted 87
10 SASI_Hs02_00520956 predicted 53
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520957 predicted 328
2 SASI_Hs02_00520958 predicted 170
3 SASI_Hs02_00520959 predicted 25
4 SASI_Hs02_00520960 predicted 34
5 SASI_Hs02_00520961 predicted 101
6 SASI_Hs02_00520962 predicted 193
7 SASI_Hs02_00520963 predicted 489
8 SASI_Hs02_00520964 predicted 339
9 SASI_Hs02_00520965 predicted 112
10 SASI_Hs02_00520966 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520967 predicted 170
2 SASI_Hs02_00520968 predicted 26
3 SASI_Hs02_00520969 predicted 32
4 SASI_Hs02_00520970 predicted 105
5 SASI_Hs02_00520971 predicted 194
6 SASI_Hs02_00520972 predicted 124
7 SASI_Hs02_00520973 predicted 342
8 SASI_Hs02_00520974 predicted 109
9 SASI_Hs02_00520975 predicted 87
10 SASI_Hs02_00520976 predicted 53
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001703
FLJ46010 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-489s1c1
Sequence:CCGGCCACTTTGGGATGCTTCCAAACTCGAGTTTGGAAGCATCCCAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-587s1c1
Sequence:CCGGGTTGTGAAGTCTCATGTCCTACTCGAGTAGGACATGAGACTTCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-286s1c1
Sequence:CCGGCAATCTCTTGACGGATCATTTCTCGAGAAATGATCCGTCAAGAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-505s1c1
Sequence:CCGGCCAAAGAAATGGGATACCAAACTCGAGTTTGGTATCCCATTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-1824s1c1
Sequence:CCGGGCTTGCTTTCTGAAATCTTATCTCGAGATAAGATTTCAGAAAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-422s1c1
Sequence:CCGGGAAGAATTGTTGTCATCCTTTCTCGAGAAAGGATGACAACAATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-597s1c1
Sequence:CCGGCTCATGTCCTATGAAGAGAAACTCGAGTTTCTCTTCATAGGACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-860s1c1
Sequence:CCGGCCAGAAGTGATGTATCAGTTTCTCGAGAAACTGATACATCACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001703
FLJ46010 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-489s1c1
Sequence:CCGGCCACTTTGGGATGCTTCCAAACTCGAGTTTGGAAGCATCCCAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-587s1c1
Sequence:CCGGGTTGTGAAGTCTCATGTCCTACTCGAGTAGGACATGAGACTTCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-286s1c1
Sequence:CCGGCAATCTCTTGACGGATCATTTCTCGAGAAATGATCCGTCAAGAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-505s1c1
Sequence:CCGGCCAAAGAAATGGGATACCAAACTCGAGTTTGGTATCCCATTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-1824s1c1
Sequence:CCGGGCTTGCTTTCTGAAATCTTATCTCGAGATAAGATTTCAGAAAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-422s1c1
Sequence:CCGGGAAGAATTGTTGTCATCCTTTCTCGAGAAAGGATGACAACAATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-597s1c1
Sequence:CCGGCTCATGTCCTATGAAGAGAAACTCGAGTTTCTCTTCATAGGACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-860s1c1
Sequence:CCGGCCAGAAGTGATGTATCAGTTTCTCGAGAAACTGATACATCACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001703
FLJ46010 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-489s1c1
Sequence:CCGGCCACTTTGGGATGCTTCCAAACTCGAGTTTGGAAGCATCCCAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-587s1c1
Sequence:CCGGGTTGTGAAGTCTCATGTCCTACTCGAGTAGGACATGAGACTTCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-286s1c1
Sequence:CCGGCAATCTCTTGACGGATCATTTCTCGAGAAATGATCCGTCAAGAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-505s1c1
Sequence:CCGGCCAAAGAAATGGGATACCAAACTCGAGTTTGGTATCCCATTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-1824s1c1
Sequence:CCGGGCTTGCTTTCTGAAATCTTATCTCGAGATAAGATTTCAGAAAGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-422s1c1
Sequence:CCGGGAAGAATTGTTGTCATCCTTTCTCGAGAAAGGATGACAACAATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001703.1-597s1c1
Sequence:CCGGCTCATGTCCTATGAAGAGAAACTCGAGTTTCTCTTCATAGGACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001703.1-860s1c1
Sequence:CCGGCCAGAAGTGATGTATCAGTTTCTCGAGAAACTGATACATCACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)