EMAIL THIS PAGE TO A FRIEND

FLJ46026

30 Gene Product Result for
Species: Human FLJ46026(400627)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207458 Rosetta Predictions human pricing
XR_041189 Rosetta Predictions human pricing
XR_041190 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221098 predicted 495
2 SASI_Hs01_00221099 predicted 445
3 SASI_Hs01_00221100 predicted 478
4 SASI_Hs01_00221101 predicted 145
5 SASI_Hs01_00221102 predicted 86
6 SASI_Hs01_00221103 predicted 39
7 SASI_Hs01_00221104 predicted 739
8 SASI_Hs01_00221105 predicted 25
9 SASI_Hs01_00221106 predicted 185
10 SASI_Hs01_00221107 predicted 135
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525382 predicted 287
2 SASI_Hs02_00525383 predicted 444
3 SASI_Hs02_00525384 predicted 445
4 SASI_Hs02_00525385 predicted 483
5 SASI_Hs02_00525386 predicted 596
6 SASI_Hs02_00525387 predicted 434
7 SASI_Hs02_00525388 predicted 614
8 SASI_Hs02_00525389 predicted 471
9 SASI_Hs02_00525390 predicted 499
10 SASI_Hs02_00525391 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525392 predicted 281
2 SASI_Hs02_00525393 predicted 453
3 SASI_Hs02_00525394 predicted 445
4 SASI_Hs02_00525395 predicted 485
5 SASI_Hs02_00525396 predicted 600
6 SASI_Hs02_00525397 predicted 437
7 SASI_Hs02_00525398 predicted 621
8 SASI_Hs02_00525399 predicted 468
9 SASI_Hs02_00525400 predicted 505
10 SASI_Hs02_00525401 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207458
FLJ46026 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-577s1c1
Sequence:CCGGGATCCACTTGTTTACCGACAGCTCGAGCTGTCGGTAAACAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-118s1c1
Sequence:CCGGCTCCTTTCAGCGATGCTGTTACTCGAGTAACAGCATCGCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-495s1c1
Sequence:CCGGGATTCCAGGATTCCATGGCAACTCGAGTTGCCATGGAATCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2625s1c1
Sequence:CCGGCCCAGATTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2241s1c1
Sequence:CCGGCAGACCTGTAATCCCAGTTATCTCGAGATAACTGGGATTACAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-129s1c1
Sequence:CCGGGATGCTGTTAAGAAAGGCAATCTCGAGATTGCCTTTCTTAACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-132s1c1
Sequence:CCGGGCTGTTAAGAAAGGCAATGAACTCGAGTTCATTGCCTTTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207458
FLJ46026 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-577s1c1
Sequence:CCGGGATCCACTTGTTTACCGACAGCTCGAGCTGTCGGTAAACAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-118s1c1
Sequence:CCGGCTCCTTTCAGCGATGCTGTTACTCGAGTAACAGCATCGCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-495s1c1
Sequence:CCGGGATTCCAGGATTCCATGGCAACTCGAGTTGCCATGGAATCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2625s1c1
Sequence:CCGGCCCAGATTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2241s1c1
Sequence:CCGGCAGACCTGTAATCCCAGTTATCTCGAGATAACTGGGATTACAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-129s1c1
Sequence:CCGGGATGCTGTTAAGAAAGGCAATCTCGAGATTGCCTTTCTTAACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-132s1c1
Sequence:CCGGGCTGTTAAGAAAGGCAATGAACTCGAGTTCATTGCCTTTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207458
FLJ46026 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-577s1c1
Sequence:CCGGGATCCACTTGTTTACCGACAGCTCGAGCTGTCGGTAAACAAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-118s1c1
Sequence:CCGGCTCCTTTCAGCGATGCTGTTACTCGAGTAACAGCATCGCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-495s1c1
Sequence:CCGGGATTCCAGGATTCCATGGCAACTCGAGTTGCCATGGAATCCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2625s1c1
Sequence:CCGGCCCAGATTTCAATGCAGACTTCTCGAGAAGTCTGCATTGAAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207458.1-2241s1c1
Sequence:CCGGCAGACCTGTAATCCCAGTTATCTCGAGATAACTGGGATTACAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207458.1-129s1c1
Sequence:CCGGGATGCTGTTAAGAAAGGCAATCTCGAGATTGCCTTTCTTAACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207458.1-132s1c1
Sequence:CCGGGCTGTTAAGAAAGGCAATGAACTCGAGTTCATTGCCTTTCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks