EMAIL THIS PAGE TO A FRIEND

FLJ46300

40 Gene Product Result for
Species: Human FLJ46300(399827)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001677 Rosetta Predictions human pricing
XR_040359 Rosetta Predictions human pricing
XR_040360 Rosetta Predictions human pricing
XR_040361 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080157 predicted 1226
2 SASI_Hs01_00080158 predicted 1293
3 SASI_Hs01_00080159 predicted 1367
4 SASI_Hs01_00080160 predicted 1079
5 SASI_Hs01_00080161 predicted 1301
6 SASI_Hs01_00080162 predicted 1294
7 SASI_Hs01_00080163 predicted 1416
8 SASI_Hs01_00080164 predicted 1260
9 SASI_Hs01_00080165 predicted 1267
10 SASI_Hs01_00080166 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518159 predicted 228
2 SASI_Hs02_00518160 predicted 202
3 SASI_Hs02_00518161 predicted 421
4 SASI_Hs02_00518162 predicted 58
5 SASI_Hs02_00518163 predicted 14
6 SASI_Hs02_00518164 predicted 414
7 SASI_Hs02_00518165 predicted 191
8 SASI_Hs02_00518166 predicted 277
9 SASI_Hs02_00518167 predicted 412
10 SASI_Hs02_00518168 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518169 predicted 227
2 SASI_Hs02_00518170 predicted 206
3 SASI_Hs02_00518171 predicted 420
4 SASI_Hs02_00518172 predicted 61
5 SASI_Hs02_00518173 predicted 7
6 SASI_Hs02_00518174 predicted 410
7 SASI_Hs02_00518175 predicted 187
8 SASI_Hs02_00518176 predicted 276
9 SASI_Hs02_00518177 predicted 66
10 SASI_Hs02_00518178 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518179 predicted 229
2 SASI_Hs02_00518180 predicted 203
3 SASI_Hs02_00518181 predicted 423
4 SASI_Hs02_00518182 predicted 61
5 SASI_Hs02_00518183 predicted 11
6 SASI_Hs02_00518184 predicted 409
7 SASI_Hs02_00518185 predicted 191
8 SASI_Hs02_00518186 predicted 270
9 SASI_Hs02_00518187 predicted 59
10 SASI_Hs02_00518188 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001677
FLJ46300 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2415s1c1
Sequence:CCGGCCCTCCCTGTTTACTTACAAACTCGAGTTTGTAAGTAAACAGGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-617s1c1
Sequence:CCGGCTCCTGGAATTGTCCTCTCTTCTCGAGAAGAGAGGACAATTCCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2595s1c1
Sequence:CCGGGCCTACGAAATAAACAGAGATCTCGAGATCTCTGTTTATTTCGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-623s1c1
Sequence:CCGGGAATTGTCCTCTCTTCTGCCACTCGAGTGGCAGAAGAGAGGACAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-1313s1c1
Sequence:CCGGCCATTAAAGATGTGGTGAGTTCTCGAGAACTCACCACATCTTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001677
FLJ46300 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2415s1c1
Sequence:CCGGCCCTCCCTGTTTACTTACAAACTCGAGTTTGTAAGTAAACAGGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-617s1c1
Sequence:CCGGCTCCTGGAATTGTCCTCTCTTCTCGAGAAGAGAGGACAATTCCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2595s1c1
Sequence:CCGGGCCTACGAAATAAACAGAGATCTCGAGATCTCTGTTTATTTCGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-623s1c1
Sequence:CCGGGAATTGTCCTCTCTTCTGCCACTCGAGTGGCAGAAGAGAGGACAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-1313s1c1
Sequence:CCGGCCATTAAAGATGTGGTGAGTTCTCGAGAACTCACCACATCTTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001677
FLJ46300 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2415s1c1
Sequence:CCGGCCCTCCCTGTTTACTTACAAACTCGAGTTTGTAAGTAAACAGGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-617s1c1
Sequence:CCGGCTCCTGGAATTGTCCTCTCTTCTCGAGAAGAGAGGACAATTCCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168748    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-2595s1c1
Sequence:CCGGGCCTACGAAATAAACAGAGATCTCGAGATCTCTGTTTATTTCGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001677.1-623s1c1
Sequence:CCGGGAATTGTCCTCTCTTCTGCCACTCGAGTGGCAGAAGAGAGGACAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168862    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001677.1-1313s1c1
Sequence:CCGGCCATTAAAGATGTGGTGAGTTCTCGAGAACTCACCACATCTTTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)