EMAIL THIS PAGE TO A FRIEND

FLJ46347

67 Gene Product Result for
Species: Human FLJ46347(389064)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177181 predicted 1071
2 SASI_Hs01_00177182 predicted 1691
3 SASI_Hs01_00177183 predicted 1750
4 SASI_Hs01_00177184 predicted 1744
5 SASI_Hs01_00177185 predicted 1677
6 SASI_Hs01_00177186 predicted 1913
7 SASI_Hs01_00177187 predicted 1682
8 SASI_Hs01_00177188 predicted 1680
9 SASI_Hs01_00177189 predicted 1394
10 SASI_Hs01_00177190 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005303
FLJ46347 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1065s1c1
Sequence:CCGGCGTGTGCACCTTGGAAATGAACTCGAGTTCATTTCCAAGGTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-235s1c1
Sequence:CCGGCCGTTGTGCGTCTTAATGTGTCTCGAGACACATTAAGACGCACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2018s1c1
Sequence:CCGGCGGCCAGAGACAGATTTCAAACTCGAGTTTGAAATCTGTCTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1518s1c1
Sequence:CCGGGAAGAAACAAAGTGCACCCGTCTCGAGACGGGTGCACTTTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2084s1c1
Sequence:CCGGCGTGACTAGATGGACTGCAAACTCGAGTTTGCAGTCCATCTAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-242s1c1
Sequence:CCGGGCGTCTTAATGTGTTTGCTCACTCGAGTGAGCAAACACATTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2887s1c1
Sequence:CCGGCAGGTTTAAGTACCAATGAAACTCGAGTTTCATTGGTACTTAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2886s1c1
Sequence:CCGGCCAGGTTTAAGTACCAATGAACTCGAGTTCATTGGTACTTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005303
FLJ46347 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1065s1c1
Sequence:CCGGCGTGTGCACCTTGGAAATGAACTCGAGTTCATTTCCAAGGTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-235s1c1
Sequence:CCGGCCGTTGTGCGTCTTAATGTGTCTCGAGACACATTAAGACGCACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2018s1c1
Sequence:CCGGCGGCCAGAGACAGATTTCAAACTCGAGTTTGAAATCTGTCTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1518s1c1
Sequence:CCGGGAAGAAACAAAGTGCACCCGTCTCGAGACGGGTGCACTTTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2084s1c1
Sequence:CCGGCGTGACTAGATGGACTGCAAACTCGAGTTTGCAGTCCATCTAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-242s1c1
Sequence:CCGGGCGTCTTAATGTGTTTGCTCACTCGAGTGAGCAAACACATTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2887s1c1
Sequence:CCGGCAGGTTTAAGTACCAATGAAACTCGAGTTTCATTGGTACTTAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2886s1c1
Sequence:CCGGCCAGGTTTAAGTACCAATGAACTCGAGTTCATTGGTACTTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005303
FLJ46347 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1065s1c1
Sequence:CCGGCGTGTGCACCTTGGAAATGAACTCGAGTTCATTTCCAAGGTGCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-235s1c1
Sequence:CCGGCCGTTGTGCGTCTTAATGTGTCTCGAGACACATTAAGACGCACAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2018s1c1
Sequence:CCGGCGGCCAGAGACAGATTTCAAACTCGAGTTTGAAATCTGTCTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-1518s1c1
Sequence:CCGGGAAGAAACAAAGTGCACCCGTCTCGAGACGGGTGCACTTTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2084s1c1
Sequence:CCGGCGTGACTAGATGGACTGCAAACTCGAGTTTGCAGTCCATCTAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005303.1-242s1c1
Sequence:CCGGGCGTCTTAATGTGTTTGCTCACTCGAGTGAGCAAACACATTAAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2887s1c1
Sequence:CCGGCAGGTTTAAGTACCAATGAAACTCGAGTTTCATTGGTACTTAAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166898    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005303.1-2886s1c1
Sequence:CCGGCCAGGTTTAAGTACCAATGAACTCGAGTTCATTGGTACTTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks