EMAIL THIS PAGE TO A FRIEND

FLJ46363

10 Gene Product Result for
Species: Human FLJ46363(400002)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378339 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207434 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153758 predicted 2060
2 SASI_Hs01_00153759 predicted 2540
3 SASI_Hs01_00153760 predicted 2142
4 SASI_Hs01_00153761 predicted 3013
5 SASI_Hs01_00153762 predicted 3077
6 SASI_Hs01_00153763 predicted 3073
7 SASI_Hs01_00153764 predicted 2572
8 SASI_Hs01_00153765 predicted 2642
9 SASI_Hs01_00153766 predicted 2798
10 SASI_Hs01_00153767 predicted 2795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378339
FLJ46363 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1754s1c1
Sequence:CCGGCCGTTACTCATTGCACAGAATCTCGAGATTCTGTGCAATGAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1685s1c1
Sequence:CCGGCAAGAGCAATGTCTTCCTGATCTCGAGATCAGGAAGACATTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378339.1-3220s1c1
Sequence:CCGGGCAATCAATCTCCAGAACTATCTCGAGATAGTTCTGGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1684s1c1
Sequence:CCGGCCAAGAGCAATGTCTTCCTGACTCGAGTCAGGAAGACATTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1829s1c1
Sequence:CCGGGCTGAGAAGAACTGCAGATCACTCGAGTGATCTGCAGTTCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1722s1c1
Sequence:CCGGGTTACTGAAATGCCAGAGGTTCTCGAGAACCTCTGGCATTTCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1837s1c1
Sequence:CCGGGAACTGCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378339
FLJ46363 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1754s1c1
Sequence:CCGGCCGTTACTCATTGCACAGAATCTCGAGATTCTGTGCAATGAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1685s1c1
Sequence:CCGGCAAGAGCAATGTCTTCCTGATCTCGAGATCAGGAAGACATTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378339.1-3220s1c1
Sequence:CCGGGCAATCAATCTCCAGAACTATCTCGAGATAGTTCTGGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1684s1c1
Sequence:CCGGCCAAGAGCAATGTCTTCCTGACTCGAGTCAGGAAGACATTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1829s1c1
Sequence:CCGGGCTGAGAAGAACTGCAGATCACTCGAGTGATCTGCAGTTCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1722s1c1
Sequence:CCGGGTTACTGAAATGCCAGAGGTTCTCGAGAACCTCTGGCATTTCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1837s1c1
Sequence:CCGGGAACTGCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378339
FLJ46363 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1754s1c1
Sequence:CCGGCCGTTACTCATTGCACAGAATCTCGAGATTCTGTGCAATGAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1685s1c1
Sequence:CCGGCAAGAGCAATGTCTTCCTGATCTCGAGATCAGGAAGACATTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_378339.1-3220s1c1
Sequence:CCGGGCAATCAATCTCCAGAACTATCTCGAGATAGTTCTGGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1684s1c1
Sequence:CCGGCCAAGAGCAATGTCTTCCTGACTCGAGTCAGGAAGACATTGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378339.1-1829s1c1
Sequence:CCGGGCTGAGAAGAACTGCAGATCACTCGAGTGATCTGCAGTTCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1722s1c1
Sequence:CCGGGTTACTGAAATGCCAGAGGTTCTCGAGAACCTCTGGCATTTCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378339.1-1837s1c1
Sequence:CCGGGAACTGCAGATCAGTCTCAAACTCGAGTTTGAGACTGATCTGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks