EMAIL THIS PAGE TO A FRIEND

FLJ46365

40 Gene Product Result for
Species: Human FLJ46365(401459)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376771 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207504 Rosetta Predictions human pricing
XR_040285 Rosetta Predictions human pricing
XR_040286 Rosetta Predictions human pricing
XR_040287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151432 predicted 532
2 SASI_Hs01_00151433 predicted 244
3 SASI_Hs01_00151434 predicted 211
4 SASI_Hs01_00151435 predicted 535
5 SASI_Hs01_00151436 predicted 228
6 SASI_Hs01_00151437 predicted 206
7 SASI_Hs01_00151438 predicted 334
8 SASI_Hs01_00151439 predicted 204
9 SASI_Hs01_00151440 predicted 230
10 SASI_Hs01_00151441 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517514 predicted 204
2 SASI_Hs02_00517515 predicted 220
3 SASI_Hs02_00517516 predicted 378
4 SASI_Hs02_00517517 predicted 355
5 SASI_Hs02_00517518 predicted 192
6 SASI_Hs02_00517519 predicted 322
7 SASI_Hs02_00517520 predicted 204
8 SASI_Hs02_00517521 predicted 232
9 SASI_Hs02_00517522 predicted 326
10 SASI_Hs02_00517523 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517524 predicted 203
2 SASI_Hs02_00517525 predicted 228
3 SASI_Hs02_00517526 predicted 381
4 SASI_Hs02_00517527 predicted 350
5 SASI_Hs02_00517528 predicted 193
6 SASI_Hs02_00517529 predicted 325
7 SASI_Hs02_00517530 predicted 207
8 SASI_Hs02_00517531 predicted 225
9 SASI_Hs02_00517532 predicted 327
10 SASI_Hs02_00517533 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517534 predicted 204
2 SASI_Hs02_00517535 predicted 220
3 SASI_Hs02_00517536 predicted 381
4 SASI_Hs02_00517537 predicted 357
5 SASI_Hs02_00517538 predicted 194
6 SASI_Hs02_00517539 predicted 321
7 SASI_Hs02_00517540 predicted 203
8 SASI_Hs02_00517541 predicted 224
9 SASI_Hs02_00517542 predicted 330
10 SASI_Hs02_00517543 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376771
FLJ46365 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3244s1c1
Sequence:CCGGCCATTCACGTTGCTGTGTGTACTCGAGTACACACAGCAACGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-194s1c1
Sequence:CCGGGATCTAACCATGACGAGAGCACTCGAGTGCTCTCGTCATGGTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-694s1c1
Sequence:CCGGGAGAGCTCTGTTGCAGTTAAACTCGAGTTTAACTGCAACAGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376771.1-654s1c1
Sequence:CCGGGTGGTCACCAAGATTGCATAACTCGAGTTATGCAATCTTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-810s1c1
Sequence:CCGGCGAGACCTCAAGATTTGTCATCTCGAGATGACAAATCTTGAGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3035s1c1
Sequence:CCGGCGTAACTGTATCACTGCTGTACTCGAGTACAGCAGTGATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-657s1c1
Sequence:CCGGGTCACCAAGATTGCATAACCACTCGAGTGGTTATGCAATCTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-178s1c1
Sequence:CCGGCCATGGCAAGATGCTAGATCTCTCGAGAGATCTAGCATCTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-1229s1c1
Sequence:CCGGCGGATGTCACTGAGAGTGAAACTCGAGTTTCACTCTCAGTGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376771
FLJ46365 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3244s1c1
Sequence:CCGGCCATTCACGTTGCTGTGTGTACTCGAGTACACACAGCAACGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-194s1c1
Sequence:CCGGGATCTAACCATGACGAGAGCACTCGAGTGCTCTCGTCATGGTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-694s1c1
Sequence:CCGGGAGAGCTCTGTTGCAGTTAAACTCGAGTTTAACTGCAACAGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376771.1-654s1c1
Sequence:CCGGGTGGTCACCAAGATTGCATAACTCGAGTTATGCAATCTTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-810s1c1
Sequence:CCGGCGAGACCTCAAGATTTGTCATCTCGAGATGACAAATCTTGAGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3035s1c1
Sequence:CCGGCGTAACTGTATCACTGCTGTACTCGAGTACAGCAGTGATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-657s1c1
Sequence:CCGGGTCACCAAGATTGCATAACCACTCGAGTGGTTATGCAATCTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-178s1c1
Sequence:CCGGCCATGGCAAGATGCTAGATCTCTCGAGAGATCTAGCATCTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-1229s1c1
Sequence:CCGGCGGATGTCACTGAGAGTGAAACTCGAGTTTCACTCTCAGTGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376771
FLJ46365 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3244s1c1
Sequence:CCGGCCATTCACGTTGCTGTGTGTACTCGAGTACACACAGCAACGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-194s1c1
Sequence:CCGGGATCTAACCATGACGAGAGCACTCGAGTGCTCTCGTCATGGTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-694s1c1
Sequence:CCGGGAGAGCTCTGTTGCAGTTAAACTCGAGTTTAACTGCAACAGAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376771.1-654s1c1
Sequence:CCGGGTGGTCACCAAGATTGCATAACTCGAGTTATGCAATCTTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-810s1c1
Sequence:CCGGCGAGACCTCAAGATTTGTCATCTCGAGATGACAAATCTTGAGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-3035s1c1
Sequence:CCGGCGTAACTGTATCACTGCTGTACTCGAGTACAGCAGTGATACAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-657s1c1
Sequence:CCGGGTCACCAAGATTGCATAACCACTCGAGTGGTTATGCAATCTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376771.1-178s1c1
Sequence:CCGGCCATGGCAAGATGCTAGATCTCTCGAGAGATCTAGCATCTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376771.1-1229s1c1
Sequence:CCGGCGGATGTCACTGAGAGTGAAACTCGAGTTTCACTCTCAGTGACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks