EMAIL THIS PAGE TO A FRIEND

FLJ46836

40 Gene Product Result for
Species: Human FLJ46836(401554)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207509 Rosetta Predictions human pricing
XR_041721 Rosetta Predictions human pricing
XR_041722 Rosetta Predictions human pricing
XR_041723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245212 predicted 2065
2 SASI_Hs01_00245213 predicted 2145
3 SASI_Hs01_00245214 predicted 1864
4 SASI_Hs01_00245215 predicted 2690
5 SASI_Hs01_00245216 predicted 2106
6 SASI_Hs01_00245217 predicted 2068
7 SASI_Hs01_00245218 predicted 1851
8 SASI_Hs01_00245219 predicted 2210
9 SASI_Hs01_00245220 predicted 2747
10 SASI_Hs01_00245221 predicted 2267
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529817 predicted 95
2 SASI_Hs02_00529818 predicted 293
3 SASI_Hs02_00529819 predicted 390
4 SASI_Hs02_00529820 predicted 370
5 SASI_Hs02_00529821 predicted 162
6 SASI_Hs02_00529822 predicted 334
7 SASI_Hs02_00529823 predicted 111
8 SASI_Hs02_00529824 predicted 442
9 SASI_Hs02_00529825 predicted 85
10 SASI_Hs02_00529826 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529827 predicted 93
2 SASI_Hs02_00529828 predicted 292
3 SASI_Hs02_00529829 predicted 383
4 SASI_Hs02_00529830 predicted 374
5 SASI_Hs02_00529831 predicted 160
6 SASI_Hs02_00529832 predicted 334
7 SASI_Hs02_00529833 predicted 103
8 SASI_Hs02_00529834 predicted 438
9 SASI_Hs02_00529835 predicted 81
10 SASI_Hs02_00529836 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529837 predicted 101
2 SASI_Hs02_00529838 predicted 296
3 SASI_Hs02_00529839 predicted 381
4 SASI_Hs02_00529840 predicted 372
5 SASI_Hs02_00529841 predicted 167
6 SASI_Hs02_00529842 predicted 335
7 SASI_Hs02_00529843 predicted 109
8 SASI_Hs02_00529844 predicted 446
9 SASI_Hs02_00529845 predicted 83
10 SASI_Hs02_00529846 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207509
FLJ46836 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2312s1c1
Sequence:CCGGCCTTCCCATTCTGAAATCCTACTCGAGTAGGATTTCAGAATGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207509.1-2746s1c1
Sequence:CCGGCCCTTGACTTAATCCTTATTACTCGAGTAATAAGGATTAAGTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2083s1c1
Sequence:CCGGCACTGGATTAGATATCAGCAACTCGAGTTGCTGATATCTAATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1870s1c1
Sequence:CCGGCTTCTGTCCTGTAAGAGCTGTCTCGAGACAGCTCTTACAGGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1945s1c1
Sequence:CCGGGAAGAGAACTGGGTTGGATCTCTCGAGAGATCCAACCCAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207509
FLJ46836 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2312s1c1
Sequence:CCGGCCTTCCCATTCTGAAATCCTACTCGAGTAGGATTTCAGAATGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207509.1-2746s1c1
Sequence:CCGGCCCTTGACTTAATCCTTATTACTCGAGTAATAAGGATTAAGTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2083s1c1
Sequence:CCGGCACTGGATTAGATATCAGCAACTCGAGTTGCTGATATCTAATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1870s1c1
Sequence:CCGGCTTCTGTCCTGTAAGAGCTGTCTCGAGACAGCTCTTACAGGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1945s1c1
Sequence:CCGGGAAGAGAACTGGGTTGGATCTCTCGAGAGATCCAACCCAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207509
FLJ46836 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2312s1c1
Sequence:CCGGCCTTCCCATTCTGAAATCCTACTCGAGTAGGATTTCAGAATGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207509.1-2746s1c1
Sequence:CCGGCCCTTGACTTAATCCTTATTACTCGAGTAATAAGGATTAAGTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-2083s1c1
Sequence:CCGGCACTGGATTAGATATCAGCAACTCGAGTTGCTGATATCTAATCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1870s1c1
Sequence:CCGGCTTCTGTCCTGTAAGAGCTGTCTCGAGACAGCTCTTACAGGACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207509.1-1945s1c1
Sequence:CCGGGAAGAGAACTGGGTTGGATCTCTCGAGAGATCCAACCCAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks