EMAIL THIS PAGE TO A FRIEND

FLJ46838

12 Gene Product Result for
Species: Human FLJ46838(440865)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007546 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137671 predicted 983
2 SASI_Hs01_00137672 predicted 2111
3 SASI_Hs01_00137674 predicted 2082
4 SASI_Hs01_00137675 predicted 1782
5 SASI_Hs02_00305339 predicted 2120
6 SASI_Hs01_00137676 predicted 1672
7 SASI_Hs01_00137677 predicted 2145
8 SASI_Hs01_00137678 predicted 1328
9 SASI_Hs01_00137679 predicted 1331
10 SASI_Hs02_00305340 predicted 1244
11 SASI_Hs01_00137673 predicted 2217
12 SASI_Hs01_00137680 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007546
FLJ46838 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-983s1c1
Sequence:CCGGCCTCCTTCTGACTGCTGTTATCTCGAGATAACAGCAGTCAGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1544s1c1
Sequence:CCGGGCAGCACACTGTTTGTTGGTACTCGAGTACCAACAAACAGTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1141s1c1
Sequence:CCGGCCAAATATTTCCTGCAGGTATCTCGAGATACCTGCAGGAAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1791s1c1
Sequence:CCGGCTGTCAGTAGTTATTATGGTTCTCGAGAACCATAATAACTACTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1816s1c1
Sequence:CCGGCAGTGTTTCCATGACAGTCTTCTCGAGAAGACTGTCATGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007546
FLJ46838 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-983s1c1
Sequence:CCGGCCTCCTTCTGACTGCTGTTATCTCGAGATAACAGCAGTCAGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1544s1c1
Sequence:CCGGGCAGCACACTGTTTGTTGGTACTCGAGTACCAACAAACAGTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1141s1c1
Sequence:CCGGCCAAATATTTCCTGCAGGTATCTCGAGATACCTGCAGGAAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1791s1c1
Sequence:CCGGCTGTCAGTAGTTATTATGGTTCTCGAGAACCATAATAACTACTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1816s1c1
Sequence:CCGGCAGTGTTTCCATGACAGTCTTCTCGAGAAGACTGTCATGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007546
FLJ46838 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-983s1c1
Sequence:CCGGCCTCCTTCTGACTGCTGTTATCTCGAGATAACAGCAGTCAGAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1544s1c1
Sequence:CCGGGCAGCACACTGTTTGTTGGTACTCGAGTACCAACAAACAGTGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1141s1c1
Sequence:CCGGCCAAATATTTCCTGCAGGTATCTCGAGATACCTGCAGGAAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1791s1c1
Sequence:CCGGCTGTCAGTAGTTATTATGGTTCTCGAGAACCATAATAACTACTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007546.1-1816s1c1
Sequence:CCGGCAGTGTTTCCATGACAGTCTTCTCGAGAAGACTGTCATGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks