EMAIL THIS PAGE TO A FRIEND

FLJ90680

40 Gene Product Result for
Species: Human FLJ90680(400926)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207475 Rosetta Predictions human pricing
XR_041668 Rosetta Predictions human pricing
XR_041669 Rosetta Predictions human pricing
XR_041670 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220126 predicted 752
2 SASI_Hs01_00220127 predicted 828
3 SASI_Hs01_00220128 predicted 766
4 SASI_Hs01_00220129 predicted 676
5 SASI_Hs01_00220130 predicted 630
6 SASI_Hs01_00220131 predicted 596
7 SASI_Hs01_00220132 predicted 949
8 SASI_Hs01_00220133 predicted 575
9 SASI_Hs01_00220134 predicted 1151
10 SASI_Hs01_00220135 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529399 predicted 475
2 SASI_Hs02_00529400 predicted 451
3 SASI_Hs02_00529401 predicted 477
4 SASI_Hs02_00529402 predicted 529
5 SASI_Hs02_00529403 predicted 506
6 SASI_Hs02_00529404 predicted 454
7 SASI_Hs02_00529405 predicted 510
8 SASI_Hs02_00529406 predicted 512
9 SASI_Hs02_00529407 predicted 533
10 SASI_Hs02_00529408 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529409 predicted 472
2 SASI_Hs02_00529410 predicted 451
3 SASI_Hs02_00529411 predicted 473
4 SASI_Hs02_00529412 predicted 529
5 SASI_Hs02_00529413 predicted 510
6 SASI_Hs02_00529414 predicted 459
7 SASI_Hs02_00529415 predicted 505
8 SASI_Hs02_00529416 predicted 505
9 SASI_Hs02_00529417 predicted 537
10 SASI_Hs02_00529418 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529419 predicted 470
2 SASI_Hs02_00529420 predicted 450
3 SASI_Hs02_00529421 predicted 479
4 SASI_Hs02_00529422 predicted 532
5 SASI_Hs02_00529423 predicted 504
6 SASI_Hs02_00529424 predicted 456
7 SASI_Hs02_00529425 predicted 505
8 SASI_Hs02_00529426 predicted 513
9 SASI_Hs02_00529427 predicted 529
10 SASI_Hs02_00529428 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207475
FLJ90680 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000168386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1338s1c1
Sequence:CCGGGCTCTGGATCAGACAATCATTCTCGAGAATGATTGTCTGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1285s1c1
Sequence:CCGGGCCCATCACCTAAATGGTTAACTCGAGTTAACCATTTAGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207475.1-552s1c1
Sequence:CCGGCACCTATTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207475
FLJ90680 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000168386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1338s1c1
Sequence:CCGGGCTCTGGATCAGACAATCATTCTCGAGAATGATTGTCTGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1285s1c1
Sequence:CCGGGCCCATCACCTAAATGGTTAACTCGAGTTAACCATTTAGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207475.1-552s1c1
Sequence:CCGGCACCTATTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207475
FLJ90680 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000168386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1338s1c1
Sequence:CCGGGCTCTGGATCAGACAATCATTCTCGAGAATGATTGTCTGATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207475.1-1285s1c1
Sequence:CCGGGCCCATCACCTAAATGGTTAACTCGAGTTAACCATTTAGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207475.1-552s1c1
Sequence:CCGGCACCTATTCAAAGATGGCTTTCTCGAGAAAGCCATCTTTGAATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks