EMAIL THIS PAGE TO A FRIEND

FLNA

filamin A, alpha

80 Gene Product Result for
Synonyms: ABP-280 ABPX CSBS CVD1 FLN FLN-A FLN1 FMD MNS NHBP OPD OPD1 OPD2 XLVD XMVD
UniProtKB ID: P21333, E9KL45, Q5HY53, Q5HY55, Q8NF52
Gene ID:
Human(2316) Summary: The protein encoded by this gene is an actin-binding protein that crosslinks actin filaments and links actin filaments to membrane glycoproteins. The encoded protein is involved in remodeling the cytoskeleton to effect changes in cell shape and migration. This protein interacts with integrins, transmembrane receptor complexes, and second messengers. Defects in this gene are a cause of several syndromes, including periventricular nodular heterotopias (PVNH1, PVNH4), otopalatodigital syndromes (OPD1, OPD2), frontometaphyseal dysplasia (FMD), Melnick-Needles syndrome (MNS), and X-linked congenital idiopathic intestinal pseudoobstruction (CIIPX). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Mouse(192176) filamin, alpha
Rat(293860) filamin A, alpha
Zebrafish(562529) filamin A, alpha (actin binding protein 280)
cow(281165) filamin A, alpha
domestic cat(101082637) filamin A, alpha
Zebrafish(100534866) filamin A, alpha
dog(481084) filamin A, alpha
chicken(395261) filamin A, alpha
sheep(101120390) filamin A, alpha
Domestic Rabbit(100328754) filamin A, alpha
naked mole-rat(101702004) filamin A, alpha
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500951 Anti-Filamin A, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA001115 Anti-FLNA antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
western blot pricing
HPA002925 Anti-FLNA antibody produced in rabbit Ab3, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503819 Anti-phospho-Filamin A (pSer2152) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
F6682 Monoclonal Anti-Filamin antibody produced in mouse ~1.0 mg/mL, clone PM6/317, purified immunoglobulin, buffered aqueous solution monkey, canine, hamster, human, bovine
immunofluorescence, western blot pricing
WH0002316M1 Monoclonal Anti-FLNA antibody produced in mouse clone 4E10-1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403831 Monoclonal Anti-FLNA antibody produced in mouse clone 3B6-1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0168 Rabbit anti-Filamin A Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, marmoset, mouse, horse, gibbon, primate, guinea pig, baboon, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157781 MISSION® esiRNA esiRNA human FLNA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110556 Rosetta Predictions human pricing
NM_001456 Rosetta Predictions human pricing
XM_001056685 Rosetta Predictions rat pricing
XM_238167 Rosetta Predictions rat pricing
NM_010227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325015 predicted 7170
2 SASI_Hs02_00325016 predicted 1082
3 SASI_Hs02_00325017 predicted 5577
4 SASI_Hs02_00325018 predicted 7440
5 SASI_Hs02_00325019 predicted 4348
6 SASI_Hs02_00325020 predicted 3446
7 SASI_Hs02_00325021 predicted 2857
8 SASI_Hs02_00325022 predicted 4526
9 SASI_Hs02_00325023 predicted 6703
10 SASI_Hs02_00325024 predicted 3251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033822 predicted 7146
2 SASI_Hs02_00331892 predicted 1086
3 SASI_Hs02_00331893 predicted 5553
4 SASI_Hs01_00033825 predicted 7411
5 SASI_Hs01_00033826 predicted 4357
6 SASI_Hs01_00033827 predicted 3440
7 SASI_Hs01_00033828 predicted 2858
8 SASI_Hs01_00033830 predicted 4521
9 SASI_Hs01_00033831 predicted 6683
10 SASI_Hs02_00331894 predicted 3246
11 SASI_Hs01_00033823 predicted 5191
12 SASI_Hs01_00033824 predicted 6282
13 SASI_Hs01_00033829 predicted 4970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284052 predicted 4229
2 SASI_Rn02_00284053 predicted 5903
3 SASI_Rn02_00284054 predicted 1428
4 SASI_Rn02_00284055 predicted 3068
5 SASI_Rn02_00284056 predicted 865
6 SASI_Rn02_00284057 predicted 2903
7 SASI_Rn02_00284058 predicted 7253
8 SASI_Rn02_00284059 predicted 4372
9 SASI_Rn02_00284060 predicted 4941
10 SASI_Rn02_00284061 predicted 6751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391246 predicted 4228
2 SASI_Rn02_00391247 predicted 5902
3 SASI_Rn02_00391248 predicted 1429
4 SASI_Rn02_00391249 predicted 3077
5 SASI_Rn02_00391250 predicted 860
6 SASI_Rn02_00391251 predicted 2898
7 SASI_Rn02_00391252 predicted 7261
8 SASI_Rn02_00391253 predicted 4373
9 SASI_Rn02_00391254 predicted 6758
10 SASI_Rn02_00391255 predicted 2477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318075 predicted 7276
2 SASI_Mm02_00318076 predicted 4356
3 SASI_Mm02_00318077 predicted 1411
4 SASI_Mm02_00318078 predicted 4861
5 SASI_Mm02_00318079 predicted 4722
6 SASI_Mm02_00318080 predicted 1719
7 SASI_Mm02_00318081 predicted 1871
8 SASI_Mm02_00318082 predicted 1637
9 SASI_Mm02_00318083 predicted 6533
10 SASI_Mm02_00318084 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001456
VALIDATED
FLNA MISSION shRNA Bacterial Glycerol Stock
filamin A, alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-1168s1c1
Sequence:CCGGGACCGCCAATAACGACAAGAACTCGAGTTCTTGTCGTTATTGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-6043s1c1
Sequence:CCGGCATGCGTATGTCCCACCTAAACTCGAGTTTAGGTGGGACATACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-5287s1c1
Sequence:CCGGCGGCACTTTCGACATCTTCTACTCGAGTAGAAGATGTCGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-2846s1c1
Sequence:CCGGCCCACCCACTTCACAGTAAATCTCGAGATTTACTGTGAAGTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-8215s1c1
Sequence:CCGGCCCGCCTGTCACTGCAGCTGCCTCGAGGCAGCTGCAGTGACAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001456.3-6684s21c1
Sequence:CCGGGGCCAACGTTGGTAGTCATTGCTCGAGCAATGACTACCAACGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001456
VALIDATED
FLNA MISSION shRNA shRNA Plasmid DNA
filamin A, alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-1168s1c1
Sequence:CCGGGACCGCCAATAACGACAAGAACTCGAGTTCTTGTCGTTATTGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-6043s1c1
Sequence:CCGGCATGCGTATGTCCCACCTAAACTCGAGTTTAGGTGGGACATACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-5287s1c1
Sequence:CCGGCGGCACTTTCGACATCTTCTACTCGAGTAGAAGATGTCGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-2846s1c1
Sequence:CCGGCCCACCCACTTCACAGTAAATCTCGAGATTTACTGTGAAGTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-8215s1c1
Sequence:CCGGCCCGCCTGTCACTGCAGCTGCCTCGAGGCAGCTGCAGTGACAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001456.3-6684s21c1
Sequence:CCGGGGCCAACGTTGGTAGTCATTGCTCGAGCAATGACTACCAACGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001456
VALIDATED
FLNA MISSION shRNA Lentiviral Transduction Particles
filamin A, alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-1168s1c1
Sequence:CCGGGACCGCCAATAACGACAAGAACTCGAGTTCTTGTCGTTATTGGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-6043s1c1
Sequence:CCGGCATGCGTATGTCCCACCTAAACTCGAGTTTAGGTGGGACATACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001456.1-5287s1c1
Sequence:CCGGCGGCACTTTCGACATCTTCTACTCGAGTAGAAGATGTCGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-2846s1c1
Sequence:CCGGCCCACCCACTTCACAGTAAATCTCGAGATTTACTGTGAAGTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001456.1-8215s1c1
Sequence:CCGGCCCGCCTGTCACTGCAGCTGCCTCGAGGCAGCTGCAGTGACAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001456.3-6684s21c1
Sequence:CCGGGGCCAACGTTGGTAGTCATTGCTCGAGCAATGACTACCAACGTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010227
FLNA MISSION shRNA Bacterial Glycerol Stock
filamin A, alpha
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-1270s21c1
Sequence:CCGGTGGAGCCCAGTGGCAATATTGCTCGAGCAATATTGCCACTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-5864s21c1
Sequence:CCGGTGACTATAGCATCCTAGTTAACTCGAGTTAACTAGGATGCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010227.2-8049s21c1
Sequence:CCGGCTAGAAGCTCCCATGGCAATGCTCGAGCATTGCCATGGGAGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-2455s21c1
Sequence:CCGGCCCATGAACCTACCTACTTTACTCGAGTAAAGTAGGTAGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010227
FLNA MISSION shRNA shRNA Plasmid DNA
filamin A, alpha
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-1270s21c1
Sequence:CCGGTGGAGCCCAGTGGCAATATTGCTCGAGCAATATTGCCACTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-5864s21c1
Sequence:CCGGTGACTATAGCATCCTAGTTAACTCGAGTTAACTAGGATGCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010227.2-8049s21c1
Sequence:CCGGCTAGAAGCTCCCATGGCAATGCTCGAGCATTGCCATGGGAGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-2455s21c1
Sequence:CCGGCCCATGAACCTACCTACTTTACTCGAGTAAAGTAGGTAGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010227
FLNA MISSION shRNA Lentiviral Transduction Particles
filamin A, alpha
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-1270s21c1
Sequence:CCGGTGGAGCCCAGTGGCAATATTGCTCGAGCAATATTGCCACTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-5864s21c1
Sequence:CCGGTGACTATAGCATCCTAGTTAACTCGAGTTAACTAGGATGCTATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010227.2-8049s21c1
Sequence:CCGGCTAGAAGCTCCCATGGCAATGCTCGAGCATTGCCATGGGAGCTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010227.2-2455s21c1
Sequence:CCGGCCCATGAACCTACCTACTTTACTCGAGTAAAGTAGGTAGGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks