EMAIL THIS PAGE TO A FRIEND

FLNB

filamin B, beta

103 Gene Product Result for
Synonyms: ABP-278 ABP-280 AOI FH1 FLN-B FLN1L LRS1 SCT TABP TAP
Gene ID:
Human(2317) Summary: This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
Mouse(286940) filamin, beta
Rat(306204) filamin B, beta
naked mole-rat(101714131) filamin B, beta
sheep(101123330) filamin B, beta
Domestic Rabbit(100008760) filamin B, beta
Zebrafish(474378) filamin B, beta (actin binding protein 278)
cow(613533) filamin B, beta
Horse(100057963) filamin B, beta
domestic cat(101098612) filamin B, beta
dog(484713) filamin B, beta
chicken(378913) filamin B, beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001457 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001457 Rosetta Predictions human pricing
NM_001107288 Rosetta Predictions rat pricing
NM_134080 Rosetta Predictions mouse pricing
XM_899437 Rosetta Predictions mouse pricing
XM_990154 Rosetta Predictions mouse pricing
XM_990180 Rosetta Predictions mouse pricing
XM_990214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095894 predicted 2090
2 SASI_Hs02_00331895 predicted 7499
3 SASI_Hs02_00331896 predicted 6931
4 SASI_Hs02_00331897 predicted 2012
5 SASI_Hs01_00095896 predicted 6214
6 SASI_Hs01_00095898 predicted 3342
7 SASI_Hs01_00095899 predicted 6028
8 SASI_Hs01_00095900 predicted 2568
9 SASI_Hs01_00095901 predicted 4189
10 SASI_Hs01_00095902 predicted 3895
11 SASI_Hs01_00095895 predicted 5139
12 SASI_Hs01_00095897 predicted 1977
13 SASI_Hs01_00095903 predicted 5324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227365 predicted 6098
2 SASI_Rn02_00227366 predicted 3414
3 SASI_Rn02_00227367 predicted 4870
4 SASI_Rn02_00227368 predicted 1905
5 SASI_Rn02_00227369 predicted 6747
6 SASI_Rn02_00227370 predicted 4718
7 SASI_Rn02_00227371 predicted 2823
8 SASI_Rn02_00227372 predicted 6836
9 SASI_Rn02_00227373 predicted 770
10 SASI_Rn02_00227374 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339292 predicted 4936
2 SASI_Mm02_00339293 predicted 6589
3 SASI_Mm02_00339294 predicted 2939
4 SASI_Mm02_00339295 predicted 2962
5 SASI_Mm02_00339296 predicted 6230
6 SASI_Mm02_00339297 predicted 6018
7 SASI_Mm02_00339298 predicted 2899
8 SASI_Mm02_00339299 predicted 2026
9 SASI_Mm02_00339300 predicted 5730
10 SASI_Mm02_00339301 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244310 predicted 281
2 SASI_Mm01_00244311 predicted 370
3 SASI_Mm01_00244312 predicted 465
4 SASI_Mm01_00244313 predicted 452
5 SASI_Mm01_00244314 predicted 445
6 SASI_Mm01_00244315 predicted 451
7 SASI_Mm01_00244316 predicted 205
8 SASI_Mm01_00244317 predicted 445
9 SASI_Mm01_00244318 predicted 379
10 SASI_Mm01_00244319 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203342 predicted 6066
2 SASI_Mm01_00203343 predicted 4938
3 SASI_Mm01_00203344 predicted 6628
4 SASI_Mm01_00203345 predicted 2939
5 SASI_Mm01_00203346 predicted 6277
6 SASI_Mm01_00203347 predicted 2901
7 SASI_Mm01_00203348 predicted 2039
8 SASI_Mm01_00203349 predicted 4923
9 SASI_Mm01_00203350 predicted 5767
10 SASI_Mm01_00203351 predicted 2303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264538 predicted 863
2 SASI_Mm01_00264539 predicted 1422
3 SASI_Mm01_00264540 predicted 2246
4 SASI_Mm01_00264541 predicted 1446
5 SASI_Mm01_00264542 predicted 1693
6 SASI_Mm01_00264543 predicted 1069
7 SASI_Mm01_00264544 predicted 2847
8 SASI_Mm01_00264545 predicted 848
9 SASI_Mm01_00264546 predicted 768
10 SASI_Mm01_00264547 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215294 predicted 2945
2 SASI_Mm01_00215295 predicted 1890
3 SASI_Mm01_00215296 predicted 3499
4 SASI_Mm01_00215297 predicted 4322
5 SASI_Mm01_00215298 predicted 941
6 SASI_Mm01_00215299 predicted 3774
7 SASI_Mm01_00215300 predicted 3148
8 SASI_Mm01_00215301 predicted 4930
9 SASI_Mm01_00215302 predicted 2930
10 SASI_Mm01_00215303 predicted 1866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134080
FLNB MISSION shRNA Bacterial Glycerol Stock
filamin B, beta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000354142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-7498s21c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-3568s21c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-4925s21c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134080.1-8189s21c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134080
FLNB MISSION shRNA shRNA Plasmid DNA
filamin B, beta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000354142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-7498s21c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-3568s21c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-4925s21c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134080.1-8189s21c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134080
FLNB MISSION shRNA Lentiviral Transduction Particles
filamin B, beta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000354142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-7498s21c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-3568s21c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134080.1-4925s21c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134080.1-8189s21c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001457
VALIDATED
FLNB MISSION shRNA Bacterial Glycerol Stock
filamin B, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-3538s21c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-6529s21c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-745s21c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-7046s21c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-5206s21c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-3504s1c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-7012s1c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001457.1-5172s1c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-711s1c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-6495s1c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001457
VALIDATED
FLNB MISSION shRNA shRNA Plasmid DNA
filamin B, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-3538s21c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-6529s21c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-745s21c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-7046s21c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-5206s21c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-3504s1c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-7012s1c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001457.1-5172s1c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-711s1c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-6495s1c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001457
VALIDATED
FLNB MISSION shRNA Lentiviral Transduction Particles
filamin B, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-3538s21c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-6529s21c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001457.2-745s21c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-7046s21c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001457.2-5206s21c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-3504s1c1
Sequence:CCGGGCTGACATTGAAATGCCCTTTCTCGAGAAAGGGCATTTCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-7012s1c1
Sequence:CCGGGCCTTCAGGAATCGGGATTAACTCGAGTTAATCCCGATTCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001457.1-5172s1c1
Sequence:CCGGCCGGGCACATATGTGATCTATCTCGAGATAGATCACATATGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-711s1c1
Sequence:CCGGCCTGTGGATAATGCACGAGAACTCGAGTTCTCGTGCATTATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001457.1-6495s1c1
Sequence:CCGGCCAGAAATCAACAGCAGTGATCTCGAGATCACTGCTGTTGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127565
VALIDATED
FLNB MISSION shRNA Bacterial Glycerol Stock
filamin B, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-5422s1c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-2158s1c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-4731s1c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-1965s1c1
Sequence:CCGGCCCACATACGATGCAAGCAAACTCGAGTTTGCTTGCATCGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-801s1c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127565
VALIDATED
FLNB MISSION shRNA shRNA Plasmid DNA
filamin B, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-5422s1c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-2158s1c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-4731s1c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-1965s1c1
Sequence:CCGGCCCACATACGATGCAAGCAAACTCGAGTTTGCTTGCATCGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-801s1c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127565
VALIDATED
FLNB MISSION shRNA Lentiviral Transduction Particles
filamin B, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-5422s1c1
Sequence:CCGGGCCCAAATCAAGACTCTTAATCTCGAGATTAAGAGTCTTGATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-2158s1c1
Sequence:CCGGCCGTTACCTATATCCCTGATACTCGAGTATCAGGGATATAGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-4731s1c1
Sequence:CCGGGCTCCTGGAAATTACCTGATTCTCGAGAATCAGGTAATTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-1965s1c1
Sequence:CCGGCCCACATACGATGCAAGCAAACTCGAGTTTGCTTGCATCGTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127565.6-801s1c1
Sequence:CCGGGCCGACATTGAAATGCCGTTTCTCGAGAAACGGCATTTCAATGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks