EMAIL THIS PAGE TO A FRIEND

FLNC

filamin C, gamma

152 Gene Product Result for
Synonyms: ABP-280 ABP280A ABPA ABPL FLN2 MFM5 MPD4
Gene ID:
Human(2318) Summary: This gene encodes one of three related filamin genes, specifically gamma filamin. These filamin proteins crosslink actin filaments into orthogonal networks in cortical cytoplasm and participate in the anchoring of membrane proteins for the actin cytoskeleton. Three functional domains exist in filamin: an N-terminal filamentous actin-binding domain, a C-terminal self-association domain, and a membrane glycoprotein-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68794) filamin C, gamma
Rat(362332) filamin C, gamma
chicken(395260) filamin C, gamma
domestic cat(101081210) filamin C, gamma
cow(528415) filamin C, gamma
dog(482266) filamin C, gamma
sheep(101104655) filamin C, gamma
naked mole-rat(101714775) filamin C, gamma
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127487 Rosetta Predictions human pricing
NM_001458 Rosetta Predictions human pricing
XM_001061717 Rosetta Predictions rat pricing
XM_001061768 Rosetta Predictions rat pricing
XM_001061822 Rosetta Predictions rat pricing
XM_342653 Rosetta Predictions rat pricing
NM_001081185 Rosetta Predictions mouse pricing
XM_284175 Rosetta Predictions mouse pricing
XM_898823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329644 predicted 3157
2 SASI_Hs02_00329645 predicted 5045
3 SASI_Hs02_00329646 predicted 5889
4 SASI_Hs02_00329647 predicted 2404
5 SASI_Hs02_00329648 predicted 5807
6 SASI_Hs02_00329649 predicted 1281
7 SASI_Hs02_00329650 predicted 5015
8 SASI_Hs02_00329651 predicted 3946
9 SASI_Hs02_00329652 predicted 3641
10 SASI_Hs02_00329653 predicted 4435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040917 predicted 3156
2 SASI_Hs01_00040918 predicted 5040
3 SASI_Hs01_00040919 predicted 5985
4 SASI_Hs01_00040920 predicted 2412
5 SASI_Hs01_00040921 predicted 5907
6 SASI_Hs01_00040922 predicted 1278
7 SASI_Hs01_00040923 predicted 5012
8 SASI_Hs01_00040924 predicted 3949
9 SASI_Hs01_00040925 predicted 3647
10 SASI_Hs01_00040926 predicted 4434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301122 predicted 6197
2 SASI_Rn02_00301123 predicted 2393
3 SASI_Rn02_00301124 predicted 5303
4 SASI_Rn02_00301125 predicted 1790
5 SASI_Rn02_00301126 predicted 2400
6 SASI_Rn02_00301127 predicted 5716
7 SASI_Rn02_00301128 predicted 4089
8 SASI_Rn02_00301129 predicted 5966
9 SASI_Rn02_00301130 predicted 5012
10 SASI_Rn02_00301131 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301285 predicted 6195
2 SASI_Rn02_00301286 predicted 2390
3 SASI_Rn02_00301287 predicted 5303
4 SASI_Rn02_00301288 predicted 1789
5 SASI_Rn02_00301289 predicted 2401
6 SASI_Rn02_00301290 predicted 5712
7 SASI_Rn02_00301291 predicted 4092
8 SASI_Rn02_00301292 predicted 5972
9 SASI_Rn02_00301293 predicted 5013
10 SASI_Rn02_00301294 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301438 predicted 6097
2 SASI_Rn02_00301439 predicted 2395
3 SASI_Rn02_00301440 predicted 5298
4 SASI_Rn02_00301441 predicted 1793
5 SASI_Rn02_00301442 predicted 2409
6 SASI_Rn02_00301443 predicted 5610
7 SASI_Rn02_00301444 predicted 4092
8 SASI_Rn02_00301445 predicted 5873
9 SASI_Rn02_00301446 predicted 5013
10 SASI_Rn02_00301447 predicted 2308
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394610 predicted 6198
2 SASI_Rn02_00394611 predicted 2388
3 SASI_Rn02_00394612 predicted 5292
4 SASI_Rn02_00394613 predicted 1792
5 SASI_Rn02_00394614 predicted 2404
6 SASI_Rn02_00394615 predicted 5714
7 SASI_Rn02_00394616 predicted 4092
8 SASI_Rn02_00394617 predicted 5972
9 SASI_Rn02_00394618 predicted 5007
10 SASI_Rn02_00394619 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296021 predicted 6298
2 SASI_Mm02_00296022 predicted 4257
3 SASI_Mm02_00296023 predicted 4547
4 SASI_Mm02_00296024 predicted 1034
5 SASI_Mm02_00296025 predicted 6156
6 SASI_Mm02_00296026 predicted 5118
7 SASI_Mm02_00296027 predicted 7986
8 SASI_Mm02_00296028 predicted 4189
9 SASI_Mm02_00296029 predicted 6076
10 SASI_Mm02_00296030 predicted 2641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222088 predicted 6308
2 SASI_Mm01_00222089 predicted 4266
3 SASI_Mm01_00222090 predicted 4548
4 SASI_Mm01_00222091 predicted 1040
5 SASI_Mm01_00222092 predicted 6160
6 SASI_Mm01_00222093 predicted 5125
7 SASI_Mm01_00222094 predicted 7997
8 SASI_Mm01_00222095 predicted 4194
9 SASI_Mm01_00222096 predicted 6085
10 SASI_Mm01_00222097 predicted 2653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280466 predicted 378
2 SASI_Mm01_00280467 predicted 768
3 SASI_Mm01_00280468 predicted 804
4 SASI_Mm01_00280469 predicted 669
5 SASI_Mm01_00280470 predicted 699
6 SASI_Mm01_00280471 predicted 978
7 SASI_Mm01_00280472 predicted 906
8 SASI_Mm01_00280473 predicted 632
9 SASI_Mm01_00280474 predicted 455
10 SASI_Mm01_00280475 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001458
VALIDATED
FLNC MISSION shRNA Bacterial Glycerol Stock
filamin C, gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-1019s1c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-2048s1c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-7609s1c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-5146s1c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001458.1-5684s1c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-1179s21c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5844s21c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-2208s21c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5306s21c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-7769s21c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001458
VALIDATED
FLNC MISSION shRNA shRNA Plasmid DNA
filamin C, gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-1019s1c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-2048s1c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-7609s1c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-5146s1c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001458.1-5684s1c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-1179s21c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5844s21c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-2208s21c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5306s21c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-7769s21c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001458
VALIDATED
FLNC MISSION shRNA Lentiviral Transduction Particles
filamin C, gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-1019s1c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-2048s1c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-7609s1c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001458.1-5146s1c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001458.1-5684s1c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-1179s21c1
Sequence:CCGGGCTAAGGTGGTTCCCAACAATCTCGAGATTGTTGGGAACCACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5844s21c1
Sequence:CCGGACCTTCACTATTGTCACCAAACTCGAGTTTGGTGACAATAGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-2208s21c1
Sequence:CCGGCCAGATAAGGTGAAGGCCTTTCTCGAGAAAGGCCTTCACCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-5306s21c1
Sequence:CCGGCGGTACCTTTGACATCTACTACTCGAGTAGTAGATGTCAAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001458.4-7769s21c1
Sequence:CCGGCGGTGTGTCATCAGAGTTCATCTCGAGATGAACTCTGATGACACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081185
VALIDATED
FLNC MISSION shRNA Bacterial Glycerol Stock
filamin C, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-2650s21c1
Sequence:CCGGGCCAATGAACCCACCTATTTCCTCGAGGAAATAGGTGGGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-2599s21c1
Sequence:CCGGCCTGAGCGGGTGAAGGTATATCTCGAGATATACCTTCACCCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-8673s21c1
Sequence:CCGGTCAGATCAGTGTCCCTCAAATCTCGAGATTTGAGGGACACTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-6503s21c1
Sequence:CCGGACACTCGCAATGCAGGTTATGCTCGAGCATAACCTGCATTGCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-7870s21c1
Sequence:CCGGGGCGTATCATCAGAGTTTATTCTCGAGAATAAACTCTGATGATACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081185
VALIDATED
FLNC MISSION shRNA shRNA Plasmid DNA
filamin C, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-2650s21c1
Sequence:CCGGGCCAATGAACCCACCTATTTCCTCGAGGAAATAGGTGGGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-2599s21c1
Sequence:CCGGCCTGAGCGGGTGAAGGTATATCTCGAGATATACCTTCACCCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-8673s21c1
Sequence:CCGGTCAGATCAGTGTCCCTCAAATCTCGAGATTTGAGGGACACTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-6503s21c1
Sequence:CCGGACACTCGCAATGCAGGTTATGCTCGAGCATAACCTGCATTGCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-7870s21c1
Sequence:CCGGGGCGTATCATCAGAGTTTATTCTCGAGAATAAACTCTGATGATACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081185
VALIDATED
FLNC MISSION shRNA Lentiviral Transduction Particles
filamin C, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-2650s21c1
Sequence:CCGGGCCAATGAACCCACCTATTTCCTCGAGGAAATAGGTGGGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-2599s21c1
Sequence:CCGGCCTGAGCGGGTGAAGGTATATCTCGAGATATACCTTCACCCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-8673s21c1
Sequence:CCGGTCAGATCAGTGTCCCTCAAATCTCGAGATTTGAGGGACACTGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081185.1-6503s21c1
Sequence:CCGGACACTCGCAATGCAGGTTATGCTCGAGCATAACCTGCATTGCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081185.1-7870s21c1
Sequence:CCGGGGCGTATCATCAGAGTTTATTCTCGAGAATAAACTCTGATGATACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks