EMAIL THIS PAGE TO A FRIEND

FLOT1

flotillin 1

54 Gene Product Result for
UniProtKB ID: O75955, Q969J8, Q9UHW1, Q9UNV8
Gene ID:
Human(10211) Summary: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. FLOT1 encodes a caveolae-associated, integral membrane protein. The function of flotillin 1 has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14251) flotillin 1
Rat(64665) flotillin 1
chicken(101664786) flotillin 1
cow(532573) flotillin 1
dog(474831) flotillin 1
chicken(101751397) flotillin 1
Goat(100860982) flotillin 1
sheep(101105287) flotillin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005803 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002671 MISSION® esiRNA esiRNA targeting mouse Flot1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005803 Rosetta Predictions human pricing
NM_022701 Rosetta Predictions rat pricing
NM_008027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229858 predicted 1561
2 SASI_Hs01_00229859 predicted 1278
3 SASI_Hs01_00229860 predicted 822
4 SASI_Hs01_00229861 predicted 1576
5 SASI_Hs01_00229862 predicted 1340
6 SASI_Hs01_00229863 predicted 1032
7 SASI_Hs01_00229864 predicted 1540
8 SASI_Hs01_00229866 predicted 449
9 SASI_Hs02_00340312 predicted 1572
10 SASI_Hs01_00229867 predicted 1470
11 SASI_Hs01_00229865 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118464 predicted 685
2 SASI_Rn01_00118465 predicted 512
3 SASI_Rn02_00263505 predicted 1308
4 SASI_Rn01_00118469 predicted 615
5 SASI_Rn01_00118470 predicted 832
6 SASI_Rn01_00118471 predicted 1196
7 SASI_Rn01_00118472 predicted 1283
8 SASI_Rn02_00263506 predicted 1393
9 SASI_Rn01_00118473 predicted 911
10 SASI_Rn02_00263507 predicted 547
11 SASI_Rn01_00118466 predicted 616
12 SASI_Rn01_00118467 predicted 641
13 SASI_Rn01_00118468 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312975 predicted 502
2 SASI_Mm02_00312976 predicted 623
3 SASI_Mm02_00312977 predicted 818
4 SASI_Mm02_00312978 predicted 594
5 SASI_Mm02_00312979 predicted 1418
6 SASI_Mm02_00312980 predicted 598
7 SASI_Mm02_00312981 predicted 532
8 SASI_Mm02_00312982 predicted 1293
9 SASI_Mm02_00312983 predicted 1178
10 SASI_Mm02_00312984 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008027
VALIDATED
FLOT1 MISSION shRNA Bacterial Glycerol Stock
flotillin 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-760s21c1
Sequence:GTACCGGGCACAGTGCCTCAGTGAAATACTCGAGTATTTCACTGAGGCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-504s21c1
Sequence:CCGGGACTGTGGAGGAGATCTATAACTCGAGTTATAGATCTCCTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-623s21c1
Sequence:CCGGATGATGACCAGGATTACTTACCTCGAGGTAAGTAATCCTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-592s21c1
Sequence:CCGGAGCGTGGTTAGCTACACTTTGCTCGAGCAAAGTGTAGCTAACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1548s21c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1414s21c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-1152s21c1
Sequence:GTACCGGTCGTGCTGAGGCTGAGCAAATCTCGAGATTTGCTCAGCCTCAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1548s1c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-631s1c1
Sequence:CCGGCAGGATTACTTACACTCGTTACTCGAGTAACGAGTGTAAGTAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1414s1c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008027.1-252s1c1
Sequence:CCGGCCTACCCTGCATTCAGCAAATCTCGAGATTTGCTGAATGCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-630s1c1
Sequence:CCGGCCAGGATTACTTACACTCGTTCTCGAGAACGAGTGTAAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008027
VALIDATED
FLOT1 MISSION shRNA shRNA Plasmid DNA
flotillin 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-760s21c1
Sequence:GTACCGGGCACAGTGCCTCAGTGAAATACTCGAGTATTTCACTGAGGCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-504s21c1
Sequence:CCGGGACTGTGGAGGAGATCTATAACTCGAGTTATAGATCTCCTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-623s21c1
Sequence:CCGGATGATGACCAGGATTACTTACCTCGAGGTAAGTAATCCTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-592s21c1
Sequence:CCGGAGCGTGGTTAGCTACACTTTGCTCGAGCAAAGTGTAGCTAACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1548s21c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1414s21c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-1152s21c1
Sequence:GTACCGGTCGTGCTGAGGCTGAGCAAATCTCGAGATTTGCTCAGCCTCAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1548s1c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-631s1c1
Sequence:CCGGCAGGATTACTTACACTCGTTACTCGAGTAACGAGTGTAAGTAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1414s1c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008027.1-252s1c1
Sequence:CCGGCCTACCCTGCATTCAGCAAATCTCGAGATTTGCTGAATGCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-630s1c1
Sequence:CCGGCCAGGATTACTTACACTCGTTCTCGAGAACGAGTGTAAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008027
VALIDATED
FLOT1 MISSION shRNA Lentiviral Transduction Particles
flotillin 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-760s21c1
Sequence:GTACCGGGCACAGTGCCTCAGTGAAATACTCGAGTATTTCACTGAGGCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-504s21c1
Sequence:CCGGGACTGTGGAGGAGATCTATAACTCGAGTTATAGATCTCCTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-623s21c1
Sequence:CCGGATGATGACCAGGATTACTTACCTCGAGGTAAGTAATCCTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-592s21c1
Sequence:CCGGAGCGTGGTTAGCTACACTTTGCTCGAGCAAAGTGTAGCTAACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1548s21c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008027.2-1414s21c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008027.2-1152s21c1
Sequence:GTACCGGTCGTGCTGAGGCTGAGCAAATCTCGAGATTTGCTCAGCCTCAGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1548s1c1
Sequence:CCGGGCACACCTCTCCTTGCCAAATCTCGAGATTTGGCAAGGAGAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-631s1c1
Sequence:CCGGCAGGATTACTTACACTCGTTACTCGAGTAACGAGTGTAAGTAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-1414s1c1
Sequence:CCGGGTAAATCACAACAAGCCTTTACTCGAGTAAAGGCTTGTTGTGATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008027.1-252s1c1
Sequence:CCGGCCTACCCTGCATTCAGCAAATCTCGAGATTTGCTGAATGCAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008027.1-630s1c1
Sequence:CCGGCCAGGATTACTTACACTCGTTCTCGAGAACGAGTGTAAGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005803
VALIDATED
FLOT1 MISSION shRNA Bacterial Glycerol Stock
flotillin 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-457s21c1
Sequence:GTACCGGACATTGCCCTGGAGACGTTAGCTCGAGCTAACGTCTCCAGGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-627s21c1
Sequence:CCGGCACGATGACCAGGACTATTTGCTCGAGCAAATAGTCCTGGTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-1062s21c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-508s21c1
Sequence:CCGGTGACTGTGGAGGAGATCTATACTCGAGTATAGATCTCCTCCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1478s21c1
Sequence:CCGGATAGCTGAAGTTGCCTGAATGCTCGAGCATTCAGGCAACTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-304s21c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-359s21c1
Sequence:GTACCGGCACTGGCATTGCCCAGGTAAACTCGAGTTTACCTGGGCAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1569s21c1
Sequence:GTACCGGCTCTCCTTGCCAAATAGTTTGCTCGAGCAAACTATTTGGCAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1349s21c1
Sequence:GTACCGGGGAAGTACTGGACATTCTAACCTCGAGGTTAGAATGTCCAGTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-635s1c1
Sequence:CCGGCCAGGACTATTTGCACTCTTTCTCGAGAAAGAGTGCAAATAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1062s1c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-800s1c1
Sequence:CCGGACAGAGAGATTACGAACTGAACTCGAGTTCAGTTCGTAATCTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-304s1c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1415s1c1
Sequence:CCGGCCAGGTGAATCACAAGCCTTTCTCGAGAAAGGCTTGTGATTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005803
VALIDATED
FLOT1 MISSION shRNA shRNA Plasmid DNA
flotillin 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-457s21c1
Sequence:GTACCGGACATTGCCCTGGAGACGTTAGCTCGAGCTAACGTCTCCAGGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-627s21c1
Sequence:CCGGCACGATGACCAGGACTATTTGCTCGAGCAAATAGTCCTGGTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-1062s21c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-508s21c1
Sequence:CCGGTGACTGTGGAGGAGATCTATACTCGAGTATAGATCTCCTCCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1478s21c1
Sequence:CCGGATAGCTGAAGTTGCCTGAATGCTCGAGCATTCAGGCAACTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-304s21c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-359s21c1
Sequence:GTACCGGCACTGGCATTGCCCAGGTAAACTCGAGTTTACCTGGGCAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1569s21c1
Sequence:GTACCGGCTCTCCTTGCCAAATAGTTTGCTCGAGCAAACTATTTGGCAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1349s21c1
Sequence:GTACCGGGGAAGTACTGGACATTCTAACCTCGAGGTTAGAATGTCCAGTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-635s1c1
Sequence:CCGGCCAGGACTATTTGCACTCTTTCTCGAGAAAGAGTGCAAATAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1062s1c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-800s1c1
Sequence:CCGGACAGAGAGATTACGAACTGAACTCGAGTTCAGTTCGTAATCTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-304s1c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1415s1c1
Sequence:CCGGCCAGGTGAATCACAAGCCTTTCTCGAGAAAGGCTTGTGATTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005803
VALIDATED
FLOT1 MISSION shRNA Lentiviral Transduction Particles
flotillin 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-457s21c1
Sequence:GTACCGGACATTGCCCTGGAGACGTTAGCTCGAGCTAACGTCTCCAGGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-627s21c1
Sequence:CCGGCACGATGACCAGGACTATTTGCTCGAGCAAATAGTCCTGGTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-1062s21c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-508s21c1
Sequence:CCGGTGACTGTGGAGGAGATCTATACTCGAGTATAGATCTCCTCCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1478s21c1
Sequence:CCGGATAGCTGAAGTTGCCTGAATGCTCGAGCATTCAGGCAACTTCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-304s21c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005803.2-359s21c1
Sequence:GTACCGGCACTGGCATTGCCCAGGTAAACTCGAGTTTACCTGGGCAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1569s21c1
Sequence:GTACCGGCTCTCCTTGCCAAATAGTTTGCTCGAGCAAACTATTTGGCAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005803.2-1349s21c1
Sequence:GTACCGGGGAAGTACTGGACATTCTAACCTCGAGGTTAGAATGTCCAGTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-635s1c1
Sequence:CCGGCCAGGACTATTTGCACTCTTTCTCGAGAAAGAGTGCAAATAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1062s1c1
Sequence:CCGGGCAGAGAAGTCCCAACTAATTCTCGAGAATTAGTTGGGACTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-800s1c1
Sequence:CCGGACAGAGAGATTACGAACTGAACTCGAGTTCAGTTCGTAATCTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-304s1c1
Sequence:CCGGCCCTCAATGTCAAGAGTGAAACTCGAGTTTCACTCTTGACATTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005803.2-1415s1c1
Sequence:CCGGCCAGGTGAATCACAAGCCTTTCTCGAGAAAGGCTTGTGATTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks