EMAIL THIS PAGE TO A FRIEND

FLOT2

flotillin 2

158 Gene Product Result for
Synonyms: ECS-1 ECS1 ESA ESA1 M17S1
UniProtKB ID: Q14254
Gene ID:
Human(2319) Summary: Caveolae are small domains on the inner cell membrane involved in vesicular trafficking and signal transduction. This gene encodes a caveolae-associated, integral membrane protein, which is thought to function in neuronal signaling. [provided by RefSeq, Jul 2008]
Mouse(14252) flotillin 2
Rat(83764) flotillin 2
chicken(417579) flotillin 2
dog(610963) flotillin 2
cow(615679) flotillin 2
Horse(100072090) flotillin 2
sheep(101108401) flotillin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004475 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004475 Rosetta Predictions human pricing
NM_031830 Rosetta Predictions rat pricing
NM_001040403 Rosetta Predictions mouse pricing
NM_008028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222343 predicted 251
2 SASI_Hs01_00222344 predicted 554
3 SASI_Hs01_00222345 predicted 1137
4 SASI_Hs01_00222346 predicted 1014
5 SASI_Hs01_00222347 predicted 580
6 SASI_Hs01_00222349 predicted 384
7 SASI_Hs01_00222350 predicted 1491
8 SASI_Hs01_00222351 predicted 1237
9 SASI_Hs01_00222352 predicted 1276
10 SASI_Hs02_00337687 predicted 588
11 SASI_Hs01_00222348 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041651 predicted 538
2 SASI_Rn01_00041652 predicted 429
3 SASI_Rn01_00041653 predicted 590
4 SASI_Rn01_00041654 predicted 514
5 SASI_Rn02_00265309 predicted 1094
6 SASI_Rn01_00041655 predicted 747
7 SASI_Rn01_00041656 predicted 1199
8 SASI_Rn01_00041657 predicted 967
9 SASI_Rn01_00041658 predicted 844
10 SASI_Rn01_00041659 predicted 1307
11 SASI_Rn01_00041650 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181804 predicted 1104
2 SASI_Mm01_00181805 predicted 1686
3 SASI_Mm01_00181806 predicted 1243
4 SASI_Mm01_00181807 predicted 883
5 SASI_Mm01_00181808 predicted 1140
6 SASI_Mm01_00181809 predicted 1690
7 SASI_Mm01_00181810 predicted 1633
8 SASI_Mm01_00181811 predicted 1212
9 SASI_Mm01_00181812 predicted 472
10 SASI_Mm01_00181813 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034904 predicted 1193
2 SASI_Mm01_00034905 predicted 1783
3 SASI_Mm01_00034906 predicted 1335
4 SASI_Mm01_00034907 predicted 974
5 SASI_Mm01_00034908 predicted 1231
6 SASI_Mm01_00034909 predicted 1785
7 SASI_Mm01_00034910 predicted 1724
8 SASI_Mm01_00034911 predicted 1305
9 SASI_Mm01_00034912 predicted 568
10 SASI_Mm01_00034913 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008028
VALIDATED
FLOT2 MISSION shRNA Bacterial Glycerol Stock
flotillin 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-1207s1c1
Sequence:CCGGCTGACTAAAGTCGATGAGATTCTCGAGAATCTCATCGACTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-536s1c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1027s1c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1747s1c1
Sequence:CCGGGCCTTCAAGTTCTACATGTATCTCGAGATACATGTAGAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-721s1c1
Sequence:CCGGGCTGACTCTAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1675s21c1
Sequence:CCGGCTCCCATGCCCTCACATTAATCTCGAGATTAATGTGAGGGCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1381s21c1
Sequence:CCGGCAAGGTGACATCAGAAGTAAACTCGAGTTTACTTCTGATGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-566s21c1
Sequence:CCGGCTGACTGTAGAACAGATTTATCTCGAGATAAATCTGTTCTACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1157s21c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-666s21c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008028.2-1561s21c1
Sequence:GTACCGGACAGGGACAGCGAGAACATTTCTCGAGAAATGTTCTCGCTGTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1338s21c1
Sequence:GTACCGGTGACTAAAGTCGATGAGATTGCTCGAGCAATCTCATCGACTTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-842s21c1
Sequence:GTACCGGACCAAGATCGCTGACTCTAAGCTCGAGCTTAGAGTCAGCGATCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008028
VALIDATED
FLOT2 MISSION shRNA shRNA Plasmid DNA
flotillin 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-1207s1c1
Sequence:CCGGCTGACTAAAGTCGATGAGATTCTCGAGAATCTCATCGACTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-536s1c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1027s1c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1747s1c1
Sequence:CCGGGCCTTCAAGTTCTACATGTATCTCGAGATACATGTAGAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-721s1c1
Sequence:CCGGGCTGACTCTAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1675s21c1
Sequence:CCGGCTCCCATGCCCTCACATTAATCTCGAGATTAATGTGAGGGCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1381s21c1
Sequence:CCGGCAAGGTGACATCAGAAGTAAACTCGAGTTTACTTCTGATGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-566s21c1
Sequence:CCGGCTGACTGTAGAACAGATTTATCTCGAGATAAATCTGTTCTACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1157s21c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-666s21c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008028.2-1561s21c1
Sequence:GTACCGGACAGGGACAGCGAGAACATTTCTCGAGAAATGTTCTCGCTGTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1338s21c1
Sequence:GTACCGGTGACTAAAGTCGATGAGATTGCTCGAGCAATCTCATCGACTTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-842s21c1
Sequence:GTACCGGACCAAGATCGCTGACTCTAAGCTCGAGCTTAGAGTCAGCGATCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008028
VALIDATED
FLOT2 MISSION shRNA Lentiviral Transduction Particles
flotillin 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-1207s1c1
Sequence:CCGGCTGACTAAAGTCGATGAGATTCTCGAGAATCTCATCGACTTTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-536s1c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1027s1c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008028.1-1747s1c1
Sequence:CCGGGCCTTCAAGTTCTACATGTATCTCGAGATACATGTAGAACTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008028.1-721s1c1
Sequence:CCGGGCTGACTCTAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1675s21c1
Sequence:CCGGCTCCCATGCCCTCACATTAATCTCGAGATTAATGTGAGGGCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1381s21c1
Sequence:CCGGCAAGGTGACATCAGAAGTAAACTCGAGTTTACTTCTGATGTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-566s21c1
Sequence:CCGGCTGACTGTAGAACAGATTTATCTCGAGATAAATCTGTTCTACAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-1157s21c1
Sequence:CCGGGAAGCTGAGAAGATTCGCAAACTCGAGTTTGCGAATCTTCTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008028.2-666s21c1
Sequence:CCGGGCTTCACCATCAAGGATGTTTCTCGAGAAACATCCTTGATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008028.2-1561s21c1
Sequence:GTACCGGACAGGGACAGCGAGAACATTTCTCGAGAAATGTTCTCGCTGTCCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-1338s21c1
Sequence:GTACCGGTGACTAAAGTCGATGAGATTGCTCGAGCAATCTCATCGACTTTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008028.2-842s21c1
Sequence:GTACCGGACCAAGATCGCTGACTCTAAGCTCGAGCTTAGAGTCAGCGATCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004475
VALIDATED
FLOT2 MISSION shRNA Bacterial Glycerol Stock
flotillin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-742s1c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-447s1c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-244s1c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-1136s1c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-178s21c1
Sequence:GTACCGGTGTTGTGGTTCCGACTATAAACTCGAGTTTATAGTCGGAACCACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004475.2-1608s21c1
Sequence:GTACCGGCCCACTTTCACTGCCACTTTCCTCGAGGAAAGTGGCAGTGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-388s21c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-1280s21c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-591s21c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-886s21c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-251s21c1
Sequence:GTACCGGAGAGGATTTCCCTAGAGATTACTCGAGTAATCTCTAGGGAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004475
VALIDATED
FLOT2 MISSION shRNA shRNA Plasmid DNA
flotillin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-742s1c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-447s1c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-244s1c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-1136s1c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-178s21c1
Sequence:GTACCGGTGTTGTGGTTCCGACTATAAACTCGAGTTTATAGTCGGAACCACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004475.2-1608s21c1
Sequence:GTACCGGCCCACTTTCACTGCCACTTTCCTCGAGGAAAGTGGCAGTGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-388s21c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-1280s21c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-591s21c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-886s21c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-251s21c1
Sequence:GTACCGGAGAGGATTTCCCTAGAGATTACTCGAGTAATCTCTAGGGAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004475
VALIDATED
FLOT2 MISSION shRNA Lentiviral Transduction Particles
flotillin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-742s1c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-447s1c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-244s1c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004475.1-1136s1c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-178s21c1
Sequence:GTACCGGTGTTGTGGTTCCGACTATAAACTCGAGTTTATAGTCGGAACCACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004475.2-1608s21c1
Sequence:GTACCGGCCCACTTTCACTGCCACTTTCCTCGAGGAAAGTGGCAGTGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-388s21c1
Sequence:CCGGGAGCAGTTTCTGGGTAAGAATCTCGAGATTCTTACCCAGAAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-1280s21c1
Sequence:CCGGGAGACAACAGTAAGGTCACATCTCGAGATGTGACCTTACTGTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-591s21c1
Sequence:CCGGCGTGTATGACAAAGTGGACTACTCGAGTAGTCCACTTTGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004475.2-886s21c1
Sequence:CCGGGAAGAGATTGAGATTGAGGTTCTCGAGAACCTCAATCTCAATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004475.2-251s21c1
Sequence:GTACCGGAGAGGATTTCCCTAGAGATTACTCGAGTAATCTCTAGGGAAATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks