EMAIL THIS PAGE TO A FRIEND

FLRT2

fibronectin leucine rich transmembrane protein 2

223 Gene Product Result for
UniProtKB ID: O43155, A0AV84, B7ZLP3
Gene ID:
Human(23768) Summary: This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT family members may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. [provided by RefSeq, Jul 2008]
Mouse(399558) fibronectin leucine rich transmembrane protein 2
Rat(299236) fibronectin leucine rich transmembrane protein 2
Zebrafish(571972) fibronectin leucine rich transmembrane protein 2
cow(539905) fibronectin leucine rich transmembrane protein 2
Horse(100052762) fibronectin leucine rich transmembrane protein 2
domestic cat(101090446) fibronectin leucine rich transmembrane protein 2
dog(490820) fibronectin leucine rich transmembrane protein 2
chicken(428901) fibronectin leucine rich transmembrane protein 2
sheep(101117848) fibronectin leucine rich transmembrane protein 2
naked mole-rat(101722934) fibronectin leucine rich transmembrane protein 2
domestic guinea pig(100722453) fibronectin leucine rich transmembrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1462 Human FLRT2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041071 MISSION® esiRNA esiRNA human FLRT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013231 Rosetta Predictions human pricing
NM_001106750 Rosetta Predictions rat pricing
NM_201518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071383 predicted 2604
2 SASI_Hs01_00071384 predicted 2758
3 SASI_Hs01_00071386 predicted 1708
4 SASI_Hs01_00071387 predicted 2221
5 SASI_Hs01_00071388 predicted 1914
6 SASI_Hs01_00071390 predicted 1084
7 SASI_Hs01_00071391 predicted 976
8 SASI_Hs01_00071392 predicted 1233
9 SASI_Hs02_00344420 predicted 2021
10 SASI_Hs02_00344421 predicted 2057
11 SASI_Hs01_00071385 predicted 1574
12 SASI_Hs01_00071389 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222028 predicted 1543
2 SASI_Rn02_00222029 predicted 1672
3 SASI_Rn02_00222030 predicted 2034
4 SASI_Rn02_00222031 predicted 1748
5 SASI_Rn02_00222032 predicted 2050
6 SASI_Rn02_00222033 predicted 1184
7 SASI_Rn02_00222034 predicted 1706
8 SASI_Rn02_00222035 predicted 1610
9 SASI_Rn02_00222036 predicted 1561
10 SASI_Rn02_00222037 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075873 predicted 2199
2 SASI_Mm01_00075874 predicted 1863
3 SASI_Mm01_00075875 predicted 1587
4 SASI_Mm01_00075876 predicted 1209
5 SASI_Mm01_00075877 predicted 1648
6 SASI_Mm01_00075878 predicted 1059
7 SASI_Mm01_00075879 predicted 2083
8 SASI_Mm01_00075880 predicted 1730
9 SASI_Mm01_00075881 predicted 2494
10 SASI_Mm01_00075882 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013231
FLRT2 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1384s1c1
Sequence:CCGGCGTCAGGGAATTAAATATGAACTCGAGTTCATATTTAATTCCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-544s1c1
Sequence:CCGGCCTCCACAACAACCAAATTAACTCGAGTTAATTTGGTTGTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1132s1c1
Sequence:CCGGCCACATTCCTTTGACAGCCTTCTCGAGAAGGCTGTCAAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-2165s1c1
Sequence:CCGGGTCTCCTTAAATAACGATCAACTCGAGTTGATCGTTATTTAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1845s1c1
Sequence:CCGGCGGTAGAAGACACCATTTGTTCTCGAGAACAAATGGTGTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1376s21c1
Sequence:CCGGCACGAGCTTGGAGCGTCTTATCTCGAGATAAGACGCTCCAAGCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1524s21c1
Sequence:CCGGCATCTGATCAGGCTCTATTTGCTCGAGCAAATAGAGCCTGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013231.4-2765s21c1
Sequence:CCGGGCGTTATCAAGGCGGACAATTCTCGAGAATTGTCCGCCTTGATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013231
FLRT2 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1384s1c1
Sequence:CCGGCGTCAGGGAATTAAATATGAACTCGAGTTCATATTTAATTCCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-544s1c1
Sequence:CCGGCCTCCACAACAACCAAATTAACTCGAGTTAATTTGGTTGTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1132s1c1
Sequence:CCGGCCACATTCCTTTGACAGCCTTCTCGAGAAGGCTGTCAAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-2165s1c1
Sequence:CCGGGTCTCCTTAAATAACGATCAACTCGAGTTGATCGTTATTTAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1845s1c1
Sequence:CCGGCGGTAGAAGACACCATTTGTTCTCGAGAACAAATGGTGTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1376s21c1
Sequence:CCGGCACGAGCTTGGAGCGTCTTATCTCGAGATAAGACGCTCCAAGCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1524s21c1
Sequence:CCGGCATCTGATCAGGCTCTATTTGCTCGAGCAAATAGAGCCTGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013231.4-2765s21c1
Sequence:CCGGGCGTTATCAAGGCGGACAATTCTCGAGAATTGTCCGCCTTGATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013231
FLRT2 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1384s1c1
Sequence:CCGGCGTCAGGGAATTAAATATGAACTCGAGTTCATATTTAATTCCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-544s1c1
Sequence:CCGGCCTCCACAACAACCAAATTAACTCGAGTTAATTTGGTTGTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1132s1c1
Sequence:CCGGCCACATTCCTTTGACAGCCTTCTCGAGAAGGCTGTCAAAGGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-2165s1c1
Sequence:CCGGGTCTCCTTAAATAACGATCAACTCGAGTTGATCGTTATTTAAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013231.3-1845s1c1
Sequence:CCGGCGGTAGAAGACACCATTTGTTCTCGAGAACAAATGGTGTCTTCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1376s21c1
Sequence:CCGGCACGAGCTTGGAGCGTCTTATCTCGAGATAAGACGCTCCAAGCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013231.4-1524s21c1
Sequence:CCGGCATCTGATCAGGCTCTATTTGCTCGAGCAAATAGAGCCTGATCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013231.4-2765s21c1
Sequence:CCGGGCGTTATCAAGGCGGACAATTCTCGAGAATTGTCCGCCTTGATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201518
FLRT2 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2000s1c1
Sequence:CCGGCCCACCTATTTCTGAAAGGATCTCGAGATCCTTTCAGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2182s1c1
Sequence:CCGGGCTTGGTTAATTTAGAGCCCACTCGAGTGGGCTCTAAATTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2496s1c1
Sequence:CCGGCGGAAAGACGACTATTGTGAACTCGAGTTCACAATAGTCGTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-1665s1c1
Sequence:CCGGGCGCGGAATAACCCTTGGTTTCTCGAGAAACCAAGGGTTATTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2288s1c1
Sequence:CCGGCCATGCCTCTTATTTGAACAACTCGAGTTGTTCAAATAAGAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201518
FLRT2 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2000s1c1
Sequence:CCGGCCCACCTATTTCTGAAAGGATCTCGAGATCCTTTCAGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2182s1c1
Sequence:CCGGGCTTGGTTAATTTAGAGCCCACTCGAGTGGGCTCTAAATTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2496s1c1
Sequence:CCGGCGGAAAGACGACTATTGTGAACTCGAGTTCACAATAGTCGTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-1665s1c1
Sequence:CCGGGCGCGGAATAACCCTTGGTTTCTCGAGAAACCAAGGGTTATTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2288s1c1
Sequence:CCGGCCATGCCTCTTATTTGAACAACTCGAGTTGTTCAAATAAGAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201518
FLRT2 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2000s1c1
Sequence:CCGGCCCACCTATTTCTGAAAGGATCTCGAGATCCTTTCAGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2182s1c1
Sequence:CCGGGCTTGGTTAATTTAGAGCCCACTCGAGTGGGCTCTAAATTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2496s1c1
Sequence:CCGGCGGAAAGACGACTATTGTGAACTCGAGTTCACAATAGTCGTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-1665s1c1
Sequence:CCGGGCGCGGAATAACCCTTGGTTTCTCGAGAAACCAAGGGTTATTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201518.1-2288s1c1
Sequence:CCGGCCATGCCTCTTATTTGAACAACTCGAGTTGTTCAAATAAGAGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks