EMAIL THIS PAGE TO A FRIEND

FLRT3

fibronectin leucine rich transmembrane protein 3

Synonyms: HH21
Gene ID:
Human(23767) Summary: This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
Mouse(71436) fibronectin leucine rich transmembrane protein 3
Rat(366205) fibronectin leucine rich transmembrane protein 3
domestic guinea pig(100734380) fibronectin leucine rich transmembrane protein 3
naked mole-rat(101706088) fibronectin leucine rich transmembrane protein 3
sheep(101111731) fibronectin leucine rich transmembrane protein 3
Domestic Rabbit(100359117) fibronectin leucine rich transmembrane protein 3
Zebrafish(558864) fibronectin leucine rich transmembrane 3
chicken(428552) fibronectin leucine rich transmembrane protein 3
domestic cat(101095003) fibronectin leucine rich transmembrane protein 3
cow(529416) fibronectin leucine rich transmembrane protein 3
Horse(100051056) fibronectin leucine rich transmembrane protein 3
dog(477149) fibronectin leucine rich transmembrane protein 3
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1463 Human FLRT3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013281 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013281 Rosetta Predictions human pricing
NM_198391 Rosetta Predictions human pricing
NM_001126291 Rosetta Predictions rat pricing
NM_178382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117468 predicted 526
2 SASI_Hs02_00344537 predicted 745
3 SASI_Hs02_00344538 predicted 2020
4 SASI_Hs01_00117472 predicted 805
5 SASI_Hs02_00344539 predicted 1142
6 SASI_Hs01_00117475 predicted 1459
7 SASI_Hs01_00117476 predicted 1148
8 SASI_Hs01_00117477 predicted 1112
9 SASI_Hs02_00344540 predicted 721
10 SASI_Hs02_00344541 predicted 875
11 SASI_Hs01_00117469 predicted 621
12 SASI_Hs01_00117470 predicted 2001
13 SASI_Hs01_00117471 predicted 898
14 SASI_Hs01_00117473 predicted 437
15 SASI_Hs01_00117474 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176520 predicted 726
2 SASI_Hs02_00371907 predicted 946
3 SASI_Hs02_00371908 predicted 2225
4 SASI_Hs01_00176524 predicted 1007
5 SASI_Hs01_00176525 predicted 638
6 SASI_Hs01_00176527 predicted 1659
7 SASI_Hs01_00176528 predicted 1353
8 SASI_Hs01_00176529 predicted 1312
9 SASI_Hs02_00371909 predicted 920
10 SASI_Hs02_00371910 predicted 1084
11 SASI_Hs01_00176521 predicted 821
12 SASI_Hs01_00176522 predicted 2202
13 SASI_Hs01_00176523 predicted 1098
14 SASI_Hs01_00176526 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253283 predicted 969
2 SASI_Rn02_00253284 predicted 1860
3 SASI_Rn02_00253285 predicted 1844
4 SASI_Rn02_00253286 predicted 1632
5 SASI_Rn02_00253287 predicted 988
6 SASI_Rn02_00253288 predicted 1870
7 SASI_Rn02_00253289 predicted 507
8 SASI_Rn02_00253290 predicted 1278
9 SASI_Rn02_00253291 predicted 1771
10 SASI_Rn02_00253292 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171744 predicted 1917
2 SASI_Mm02_00348788 predicted 1584
3 SASI_Mm01_00171745 predicted 904
4 SASI_Mm01_00171746 predicted 823
5 SASI_Mm01_00171747 predicted 1925
6 SASI_Mm02_00348789 predicted 1877
7 SASI_Mm01_00171748 predicted 1343
8 SASI_Mm02_00348790 predicted 784
9 SASI_Mm01_00171749 predicted 1016
10 SASI_Mm01_00171751 predicted 1907
11 SASI_Mm01_00171750 predicted 1550
12 SASI_Mm01_00171752 predicted 1324
13 SASI_Mm01_00171753 predicted 2112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178382
VALIDATED
FLRT3 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-989s1c1
Sequence:CCGGCCCAGGACTATTGAGGAATTACTCGAGTAATTCCTCAATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-1619s1c1
Sequence:CCGGCCTGTGACCAAACAACCAGATCTCGAGATCTGGTTGTTTGGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178382.2-3172s1c1
Sequence:CCGGGCAGGGAGTATGTGTACTTAACTCGAGTTAAGTACACATACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-2174s1c1
Sequence:CCGGCGGAGGAGAAAGGATGACTATCTCGAGATAGTCATCCTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-1292s1c1
Sequence:CCGGCGACTCGATATGTCTAATAATCTCGAGATTATTAGACATATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178382
VALIDATED
FLRT3 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-989s1c1
Sequence:CCGGCCCAGGACTATTGAGGAATTACTCGAGTAATTCCTCAATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-1619s1c1
Sequence:CCGGCCTGTGACCAAACAACCAGATCTCGAGATCTGGTTGTTTGGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178382.2-3172s1c1
Sequence:CCGGGCAGGGAGTATGTGTACTTAACTCGAGTTAAGTACACATACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-2174s1c1
Sequence:CCGGCGGAGGAGAAAGGATGACTATCTCGAGATAGTCATCCTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-1292s1c1
Sequence:CCGGCGACTCGATATGTCTAATAATCTCGAGATTATTAGACATATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178382
VALIDATED
FLRT3 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-989s1c1
Sequence:CCGGCCCAGGACTATTGAGGAATTACTCGAGTAATTCCTCAATAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-1619s1c1
Sequence:CCGGCCTGTGACCAAACAACCAGATCTCGAGATCTGGTTGTTTGGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178382.2-3172s1c1
Sequence:CCGGGCAGGGAGTATGTGTACTTAACTCGAGTTAAGTACACATACTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178382.2-2174s1c1
Sequence:CCGGCGGAGGAGAAAGGATGACTATCTCGAGATAGTCATCCTTTCTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178382.2-1292s1c1
Sequence:CCGGCGACTCGATATGTCTAATAATCTCGAGATTATTAGACATATCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013281
FLRT3 MISSION shRNA Bacterial Glycerol Stock
fibronectin leucine rich transmembrane protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-2097s1c1
Sequence:CCGGCACACCATATTTCCTCCTAATCTCGAGATTAGGAGGAAATATGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-645s1c1
Sequence:CCGGCCCTATCTGGAAGAATTACATCTCGAGATGTAATTCTTCCAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-1683s1c1
Sequence:CCGGCCCTATAAAGTATGCATGGTTCTCGAGAACCATGCATACTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2778s1c1
Sequence:CCGGGCAATATCAAACTTCCTGCATCTCGAGATGCAGGAAGTTTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2764s1c1
Sequence:CCGGGTGTGAAGTAATGGGCAATATCTCGAGATATTGCCCATTACTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1352s1c1
Sequence:CCGGCATTCAGATAACCACTGCAATCTCGAGATTGCAGTGGTTATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1899s1c1
Sequence:CCGGGCTTTAGTGTGTTGGTATGTTCTCGAGAACATACCAACACACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-890s1c1
Sequence:CCGGCCTGTTGAACAATCATGGTTTCTCGAGAAACCATGATTGTTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013281
FLRT3 MISSION shRNA shRNA Plasmid DNA
fibronectin leucine rich transmembrane protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-2097s1c1
Sequence:CCGGCACACCATATTTCCTCCTAATCTCGAGATTAGGAGGAAATATGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-645s1c1
Sequence:CCGGCCCTATCTGGAAGAATTACATCTCGAGATGTAATTCTTCCAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-1683s1c1
Sequence:CCGGCCCTATAAAGTATGCATGGTTCTCGAGAACCATGCATACTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2778s1c1
Sequence:CCGGGCAATATCAAACTTCCTGCATCTCGAGATGCAGGAAGTTTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2764s1c1
Sequence:CCGGGTGTGAAGTAATGGGCAATATCTCGAGATATTGCCCATTACTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1352s1c1
Sequence:CCGGCATTCAGATAACCACTGCAATCTCGAGATTGCAGTGGTTATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1899s1c1
Sequence:CCGGGCTTTAGTGTGTTGGTATGTTCTCGAGAACATACCAACACACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-890s1c1
Sequence:CCGGCCTGTTGAACAATCATGGTTTCTCGAGAAACCATGATTGTTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013281
FLRT3 MISSION shRNA Lentiviral Transduction Particles
fibronectin leucine rich transmembrane protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-2097s1c1
Sequence:CCGGCACACCATATTTCCTCCTAATCTCGAGATTAGGAGGAAATATGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-645s1c1
Sequence:CCGGCCCTATCTGGAAGAATTACATCTCGAGATGTAATTCTTCCAGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-1683s1c1
Sequence:CCGGCCCTATAAAGTATGCATGGTTCTCGAGAACCATGCATACTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2778s1c1
Sequence:CCGGGCAATATCAAACTTCCTGCATCTCGAGATGCAGGAAGTTTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013281.2-2764s1c1
Sequence:CCGGGTGTGAAGTAATGGGCAATATCTCGAGATATTGCCCATTACTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1352s1c1
Sequence:CCGGCATTCAGATAACCACTGCAATCTCGAGATTGCAGTGGTTATCTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013281.2-1899s1c1
Sequence:CCGGGCTTTAGTGTGTTGGTATGTTCTCGAGAACATACCAACACACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013281.2-890s1c1
Sequence:CCGGCCTGTTGAACAATCATGGTTTCTCGAGAAACCATGATTGTTCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks