EMAIL THIS PAGE TO A FRIEND

FLT1

fms-related tyrosine kinase 1

Synonyms: FLT FLT-1 VEGFR-1 VEGFR1
Gene ID:
Human(2321) Summary: This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
Mouse(14254) FMS-like tyrosine kinase 1
Rat(54251) FMS-related tyrosine kinase 1
sheep(443088) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
Domestic Rabbit(100343352) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
naked mole-rat(101711333) fms-related tyrosine kinase 1
domestic guinea pig(100732326) fms-related tyrosine kinase 1
Zebrafish(544667) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
chicken(374100) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
domestic cat(101088292) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
cow(503620) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
Horse(100033957) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
Horse(100061940) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
dog(403727) fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405819 Anti-FLT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA011740 Anti-FLT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
HPA014290 Anti-FLT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry pricing
SAB1408577 Anti-FLT1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504649 Anti-phospho-VEGFR1 (pTyr1048) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4301318 Anti-phospho-VEGFR1 (pTyr1048) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4301482 Anti-phospho-VEGFR1 (pTyr1213) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4504006 Anti-phospho-VEGFR1 (pTyr1333) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
V1139 Anti-Vascular Endothelial Growth Factor Receptor 1 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, flow cytometry, neutralization, western blot pricing
SAB4500957 Anti-VEGFR1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4500958 Anti-VEGFR1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB1306546 ANTI-VGFR1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AMAB90703 Monoclonal Anti-FLT1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0344, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB90704 Monoclonal Anti-FLT1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0345, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
V4762 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-1 antibody produced in mouse clone FLT-19, tissue culture supernatant human
ELISA, immunohistochemistry, immunoprecipitation, microarray pricing
V4262 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-1 antibody produced in mouse clone FLT-11, ascites fluid human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S8567 SU 4312 ≥98% (HPLC) human pricing
S8442 SU 5416 ≥98% (HPLC) human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005441 MISSION® esiRNA esiRNA targeting human FLT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002019 Rosetta Predictions human pricing
NM_019306 Rosetta Predictions rat pricing
NM_010228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175950 predicted 3137
2 SASI_Hs02_00333027 predicted 3034
3 SASI_Hs01_00175951 predicted 3080
4 SASI_Hs01_00175952 predicted 3791
5 SASI_Hs02_00333028 predicted 1347
6 SASI_Hs01_00175955 predicted 938
7 SASI_Hs02_00333029 predicted 1214
8 SASI_Hs02_00333030 predicted 3906
9 SASI_Hs01_00175956 predicted 3650
10 SASI_Hs01_00175958 predicted 768
11 SASI_Hs01_00175953 predicted 1398
12 SASI_Hs01_00175954 predicted 1969
13 SASI_Hs01_00175957 predicted 802
14 SASI_Hs01_00175959 predicted 2774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262270 predicted 1361
2 SASI_Rn01_00083511 predicted 2176
3 SASI_Rn01_00083512 predicted 1774
4 SASI_Rn01_00083513 predicted 823
5 SASI_Rn01_00083514 predicted 598
6 SASI_Rn01_00083515 predicted 1057
7 SASI_Rn01_00083516 predicted 1155
8 SASI_Rn01_00083517 predicted 1729
9 SASI_Rn01_00083518 predicted 3334
10 SASI_Rn01_00083520 predicted 3865
11 SASI_Rn01_00083519 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054506 predicted 2285
2 SASI_Mm01_00054507 predicted 1687
3 SASI_Mm01_00054508 predicted 583
4 SASI_Mm01_00054509 predicted 1172
5 SASI_Mm01_00054510 predicted 2528
6 SASI_Mm01_00054511 predicted 1386
7 SASI_Mm01_00054512 predicted 2197
8 SASI_Mm01_00054513 predicted 847
9 SASI_Mm01_00054514 predicted 3619
10 SASI_Mm01_00054515 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010228
VALIDATED
FLT1 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010228.2-4345s1c1
Sequence:CCGGCGTGACCTTTAATCGTGCTTTCTCGAGAAAGCACGATTAAAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-4054s1c1
Sequence:CCGGCCATGAAGATAGACTTGAGAACTCGAGTTCTCAAGTCTATCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-2321s1c1
Sequence:CCGGGCCTCAGATCACTTGGTTCAACTCGAGTTGAACCAAGTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-3625s1c1
Sequence:CCGGCCACACCTGAAATCTACCAAACTCGAGTTTGGTAGATTTCAGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-613s1c1
Sequence:CCGGCGGAATCTTCAATCTACATATCTCGAGATATGTAGATTGAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1467s21c1
Sequence:CCGGACGATCTTGCTGGGCATAAAGCTCGAGCTTTATGCCCAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-322s21c1
Sequence:CCGGATGGCTCAGGGTCGAAGTTAACTCGAGTTAACTTCGACCCTGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010228.3-5258s21c1
Sequence:CCGGGTCCCAGCTATAGTTACTAAACTCGAGTTTAGTAACTATAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1388s21c1
Sequence:CCGGATTGAAGTCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-2609s21c1
Sequence:CCGGGCGGTCTTCTTCCGAAGTAAACTCGAGTTTACTTCGGAAGAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010228
VALIDATED
FLT1 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010228.2-4345s1c1
Sequence:CCGGCGTGACCTTTAATCGTGCTTTCTCGAGAAAGCACGATTAAAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-4054s1c1
Sequence:CCGGCCATGAAGATAGACTTGAGAACTCGAGTTCTCAAGTCTATCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-2321s1c1
Sequence:CCGGGCCTCAGATCACTTGGTTCAACTCGAGTTGAACCAAGTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-3625s1c1
Sequence:CCGGCCACACCTGAAATCTACCAAACTCGAGTTTGGTAGATTTCAGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-613s1c1
Sequence:CCGGCGGAATCTTCAATCTACATATCTCGAGATATGTAGATTGAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1467s21c1
Sequence:CCGGACGATCTTGCTGGGCATAAAGCTCGAGCTTTATGCCCAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-322s21c1
Sequence:CCGGATGGCTCAGGGTCGAAGTTAACTCGAGTTAACTTCGACCCTGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010228.3-5258s21c1
Sequence:CCGGGTCCCAGCTATAGTTACTAAACTCGAGTTTAGTAACTATAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1388s21c1
Sequence:CCGGATTGAAGTCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-2609s21c1
Sequence:CCGGGCGGTCTTCTTCCGAAGTAAACTCGAGTTTACTTCGGAAGAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010228
VALIDATED
FLT1 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010228.2-4345s1c1
Sequence:CCGGCGTGACCTTTAATCGTGCTTTCTCGAGAAAGCACGATTAAAGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-4054s1c1
Sequence:CCGGCCATGAAGATAGACTTGAGAACTCGAGTTCTCAAGTCTATCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-2321s1c1
Sequence:CCGGGCCTCAGATCACTTGGTTCAACTCGAGTTGAACCAAGTGATCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-3625s1c1
Sequence:CCGGCCACACCTGAAATCTACCAAACTCGAGTTTGGTAGATTTCAGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010228.2-613s1c1
Sequence:CCGGCGGAATCTTCAATCTACATATCTCGAGATATGTAGATTGAAGATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1467s21c1
Sequence:CCGGACGATCTTGCTGGGCATAAAGCTCGAGCTTTATGCCCAGCAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-322s21c1
Sequence:CCGGATGGCTCAGGGTCGAAGTTAACTCGAGTTAACTTCGACCCTGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010228.3-5258s21c1
Sequence:CCGGGTCCCAGCTATAGTTACTAAACTCGAGTTTAGTAACTATAGCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-1388s21c1
Sequence:CCGGATTGAAGTCTGCTCGCTATTTCTCGAGAAATAGCGAGCAGACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010228.3-2609s21c1
Sequence:CCGGGCGGTCTTCTTCCGAAGTAAACTCGAGTTTACTTCGGAAGAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002019
FLT1 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-1340s1c1
Sequence:CCGGCGCCGGAAGTTGTATGGTTAACTCGAGTTAACCATACAACTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-3451s1c1
Sequence:CCGGCCCGAATCTATCTTTGACAAACTCGAGTTTGTCAAAGATAGATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002019.x-5356s1c1
Sequence:CCGGCCCGTCTCTATACCAACCAAACTCGAGTTTGGTTGGTATAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-2722s1c1
Sequence:CCGGGAGAGACTTAAACTGGGCAAACTCGAGTTTGCCCAGTTTAAGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5483s1c1
Sequence:CCGGGAGCATTAGCTGGCGCATATTCTCGAGAATATGCGCCAGCTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-654s1c1
Sequence:CCGGCGTAGAGATGTACAGTGAAATCTCGAGATTTCACTGTACATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-4063s1c1
Sequence:CCGGGACTTGAGAGTAACCAGTAAACTCGAGTTTACTGGTTACTCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5020s1c1
Sequence:CCGGCCATTCTCATTCGTGGCATGTCTCGAGACATGCCACGAATGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1377s21c1
Sequence:CCGGGCCGGAAGTTGTATGGTTAAACTCGAGTTTAACCATACAACTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-3579s21c1
Sequence:CCGGTCCATACCCAGGAGTACAAATCTCGAGATTTGTACTCCTGGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-2657s21c1
Sequence:GTACCGGAGACTGACTACCTATCAATTACTCGAGTAATTGATAGGTAGTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002019.3-4367s21c1
Sequence:CCGGTGCCAGTATTATGCATATATACTCGAGTATATATGCATAATACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1438s21c1
Sequence:CCGGACTCGTGGCTACTCGTTAATTCTCGAGAATTAACGAGTAGCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002019
FLT1 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-1340s1c1
Sequence:CCGGCGCCGGAAGTTGTATGGTTAACTCGAGTTAACCATACAACTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-3451s1c1
Sequence:CCGGCCCGAATCTATCTTTGACAAACTCGAGTTTGTCAAAGATAGATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002019.x-5356s1c1
Sequence:CCGGCCCGTCTCTATACCAACCAAACTCGAGTTTGGTTGGTATAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-2722s1c1
Sequence:CCGGGAGAGACTTAAACTGGGCAAACTCGAGTTTGCCCAGTTTAAGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5483s1c1
Sequence:CCGGGAGCATTAGCTGGCGCATATTCTCGAGAATATGCGCCAGCTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-654s1c1
Sequence:CCGGCGTAGAGATGTACAGTGAAATCTCGAGATTTCACTGTACATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-4063s1c1
Sequence:CCGGGACTTGAGAGTAACCAGTAAACTCGAGTTTACTGGTTACTCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5020s1c1
Sequence:CCGGCCATTCTCATTCGTGGCATGTCTCGAGACATGCCACGAATGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1377s21c1
Sequence:CCGGGCCGGAAGTTGTATGGTTAAACTCGAGTTTAACCATACAACTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-3579s21c1
Sequence:CCGGTCCATACCCAGGAGTACAAATCTCGAGATTTGTACTCCTGGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-2657s21c1
Sequence:GTACCGGAGACTGACTACCTATCAATTACTCGAGTAATTGATAGGTAGTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002019.3-4367s21c1
Sequence:CCGGTGCCAGTATTATGCATATATACTCGAGTATATATGCATAATACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1438s21c1
Sequence:CCGGACTCGTGGCTACTCGTTAATTCTCGAGAATTAACGAGTAGCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002019
FLT1 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-1340s1c1
Sequence:CCGGCGCCGGAAGTTGTATGGTTAACTCGAGTTAACCATACAACTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-3451s1c1
Sequence:CCGGCCCGAATCTATCTTTGACAAACTCGAGTTTGTCAAAGATAGATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002019.x-5356s1c1
Sequence:CCGGCCCGTCTCTATACCAACCAAACTCGAGTTTGGTTGGTATAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002019.x-2722s1c1
Sequence:CCGGGAGAGACTTAAACTGGGCAAACTCGAGTTTGCCCAGTTTAAGTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5483s1c1
Sequence:CCGGGAGCATTAGCTGGCGCATATTCTCGAGAATATGCGCCAGCTAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-654s1c1
Sequence:CCGGCGTAGAGATGTACAGTGAAATCTCGAGATTTCACTGTACATCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002019.2-4063s1c1
Sequence:CCGGGACTTGAGAGTAACCAGTAAACTCGAGTTTACTGGTTACTCTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002019.2-5020s1c1
Sequence:CCGGCCATTCTCATTCGTGGCATGTCTCGAGACATGCCACGAATGAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1377s21c1
Sequence:CCGGGCCGGAAGTTGTATGGTTAAACTCGAGTTTAACCATACAACTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-3579s21c1
Sequence:CCGGTCCATACCCAGGAGTACAAATCTCGAGATTTGTACTCCTGGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-2657s21c1
Sequence:GTACCGGAGACTGACTACCTATCAATTACTCGAGTAATTGATAGGTAGTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002019.3-4367s21c1
Sequence:CCGGTGCCAGTATTATGCATATATACTCGAGTATATATGCATAATACTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002019.3-1438s21c1
Sequence:CCGGACTCGTGGCTACTCGTTAATTCTCGAGAATTAACGAGTAGCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks