EMAIL THIS PAGE TO A FRIEND

FLT3

fms-related tyrosine kinase 3

142 Gene Product Result for
Synonyms: CD135 FLK-2 FLK2 STK1
UniProtKB ID: P36888, A0AVG9, B7ZLT7, B7ZLT8, F5H0A0, Q13414
Gene ID:
Human(2322) Summary: This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. The receptor consists of an extracellular domain composed of five immunoglobulin-like domains, one transmembrane region, and a cytoplasmic kinase domain split into two parts by a kinase-insert domain. The receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jul 2008]
Mouse(14255) FMS-like tyrosine kinase 3
Rat(140635) fms-related tyrosine kinase 3
Zebrafish(566708) fms-related tyrosine kinase 3
chicken(100858422) fms-related tyrosine kinase 3
cow(512700) fms-related tyrosine kinase 3
Horse(100061780) fms-related tyrosine kinase 3
domestic cat(101099264) fms-related tyrosine kinase 3
dog(486025) fms-related tyrosine kinase 3
domestic guinea pig(100732047) fms-related tyrosine kinase 3
naked mole-rat(101713724) fms-related tyrosine kinase 3
sheep(101112331) fms-related tyrosine kinase 3
Domestic Rabbit(100342842) fms-related tyrosine kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F0550 Anti-Flt-3 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing
SAB4300448 Anti-FLT3 (Ab-591) antibody produced in rabbit affinity isolated antibody human
immunofluorescence pricing
SAB2900166 Anti-FLT3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB4500961 Anti-FLT3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA047539 Anti-FLT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503916 Anti-phospho-FLT3 (pTyr599) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4504610 Anti-phospho-FLT3 (pTyr842) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301293 Anti-phospho-FLT3 (pTyr842) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504611 Anti-phospho-FLT3 (pTyr969) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4700280 Monoclonal Anti-CD135 antibody produced in mouse clone BV10A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700281 Monoclonal Anti-CD135-PE antibody produced in mouse clone BV10A4, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0002322M1 Monoclonal Anti-FLT3 antibody produced in mouse clone 1A11, ascites fluid, buffered aqueous solution human
ELISA pricing
SAB1403832 Monoclonal Anti-FLT3 antibody produced in mouse clone 3H1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB1464 Human Flt-3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004119 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004119 Rosetta Predictions human pricing
XM_001068655 Rosetta Predictions rat pricing
XM_221874 Rosetta Predictions rat pricing
NM_010229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336964 predicted 1136
2 SASI_Hs01_00050612 predicted 702
3 SASI_Hs01_00050613 predicted 1037
4 SASI_Hs01_00050617 predicted 230
5 SASI_Hs01_00050618 predicted 1993
6 SASI_Hs01_00050619 predicted 3098
7 SASI_Hs02_00336965 predicted 1440
8 SASI_Hs01_00050620 predicted 881
9 SASI_Hs01_00050621 predicted 1606
10 SASI_Hs02_00336966 predicted 1452
11 SASI_Hs01_00050614 predicted 818
12 SASI_Hs01_00050615 predicted 3028
13 SASI_Hs01_00050616 predicted 1740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325330 predicted 1575
2 SASI_Rn02_00325331 predicted 2421
3 SASI_Rn02_00325332 predicted 3242
4 SASI_Rn02_00325333 predicted 1232
5 SASI_Rn02_00325334 predicted 879
6 SASI_Rn02_00325335 predicted 2183
7 SASI_Rn02_00325336 predicted 3081
8 SASI_Rn02_00325337 predicted 1191
9 SASI_Rn02_00325338 predicted 1475
10 SASI_Rn02_00325339 predicted 2770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380368 predicted 1432
2 SASI_Rn02_00380369 predicted 1072
3 SASI_Rn02_00380370 predicted 1084
4 SASI_Rn02_00380371 predicted 724
5 SASI_Rn02_00380372 predicted 2038
6 SASI_Rn02_00380373 predicted 1041
7 SASI_Rn02_00380374 predicted 1333
8 SASI_Rn02_00380375 predicted 1331
9 SASI_Rn02_00380376 predicted 1060
10 SASI_Rn02_00380377 predicted 1888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185875 predicted 1758
2 SASI_Mm01_00185877 predicted 588
3 SASI_Mm01_00185878 predicted 667
4 SASI_Mm01_00185879 predicted 880
5 SASI_Mm01_00185880 predicted 1179
6 SASI_Mm02_00318085 predicted 728
7 SASI_Mm01_00185881 predicted 1034
8 SASI_Mm01_00185882 predicted 2317
9 SASI_Mm01_00185883 predicted 435
10 SASI_Mm02_00318086 predicted 2130
11 SASI_Mm01_00185876 predicted 528
12 SASI_Mm01_00185884 predicted 2900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004119
VALIDATED
FLT3 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-2633s1c1
Sequence:CCGGGCCTGTTTGAAGGCATCTACACTCGAGTGTAGATGCCTTCAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.1-1249s1c1
Sequence:CCGGGATAACGGATACAGCATATCCCTCGAGGGATATGCTGTATCCGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-3316s1c1
Sequence:CCGGGTACCTGAAGTACAGTATATTCTCGAGAATATACTGTACTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-817s1c1
Sequence:CCGGCAGACCACATTGCCACAATTACTCGAGTAATTGTGGCAATGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1115s1c1
Sequence:CCGGCCAATTCAAGTGAAGATTATGCTCGAGCATAATCTTCACTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004119.1-2392s1c1
Sequence:CCGGGACTTGAATGTGCTTACATTTCTCGAGAAATGTAAGCACATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.x-1059s1c1
Sequence:CCGGGCATCCCAGTCAATCAGCTTTCTCGAGAAAGCTGATTGACTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2461s1c1
Sequence:CCGGCTGGAATTTAAGTCGTGTGTTCTCGAGAACACACGACTTAAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2237s1c1
Sequence:CCGGCCACTTTCCAATCACATCCAACTCGAGTTGGATGTGATTGGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2908s1c1
Sequence:CCGGAAGAAGCGATGTATCAGAATCTCGAGATTCTGATACATCGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004119.x-3176s1c1
Sequence:CCGGCGTCTGCGTTTACTCTTGTTTCTCGAGAAACAAGAGTAAACGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2743s1c1
Sequence:CCGGGCTAACTTCTACAAACTGATTCTCGAGAATCAGTTTGTAGAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-139s1c1
Sequence:CCGGCAAGATCTGCCTGTGATCAAGCTCGAGCTTGATCACAGGCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1734s1c1
Sequence:CCGGCCTGCTAATTTGTCACAAGTACTCGAGTACTTGTGACAAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004119
VALIDATED
FLT3 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-2633s1c1
Sequence:CCGGGCCTGTTTGAAGGCATCTACACTCGAGTGTAGATGCCTTCAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.1-1249s1c1
Sequence:CCGGGATAACGGATACAGCATATCCCTCGAGGGATATGCTGTATCCGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-3316s1c1
Sequence:CCGGGTACCTGAAGTACAGTATATTCTCGAGAATATACTGTACTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-817s1c1
Sequence:CCGGCAGACCACATTGCCACAATTACTCGAGTAATTGTGGCAATGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1115s1c1
Sequence:CCGGCCAATTCAAGTGAAGATTATGCTCGAGCATAATCTTCACTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004119.1-2392s1c1
Sequence:CCGGGACTTGAATGTGCTTACATTTCTCGAGAAATGTAAGCACATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.x-1059s1c1
Sequence:CCGGGCATCCCAGTCAATCAGCTTTCTCGAGAAAGCTGATTGACTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2461s1c1
Sequence:CCGGCTGGAATTTAAGTCGTGTGTTCTCGAGAACACACGACTTAAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2237s1c1
Sequence:CCGGCCACTTTCCAATCACATCCAACTCGAGTTGGATGTGATTGGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2908s1c1
Sequence:CCGGAAGAAGCGATGTATCAGAATCTCGAGATTCTGATACATCGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004119.x-3176s1c1
Sequence:CCGGCGTCTGCGTTTACTCTTGTTTCTCGAGAAACAAGAGTAAACGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2743s1c1
Sequence:CCGGGCTAACTTCTACAAACTGATTCTCGAGAATCAGTTTGTAGAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-139s1c1
Sequence:CCGGCAAGATCTGCCTGTGATCAAGCTCGAGCTTGATCACAGGCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1734s1c1
Sequence:CCGGCCTGCTAATTTGTCACAAGTACTCGAGTACTTGTGACAAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004119
VALIDATED
FLT3 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-2633s1c1
Sequence:CCGGGCCTGTTTGAAGGCATCTACACTCGAGTGTAGATGCCTTCAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.1-1249s1c1
Sequence:CCGGGATAACGGATACAGCATATCCCTCGAGGGATATGCTGTATCCGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-3316s1c1
Sequence:CCGGGTACCTGAAGTACAGTATATTCTCGAGAATATACTGTACTTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-817s1c1
Sequence:CCGGCAGACCACATTGCCACAATTACTCGAGTAATTGTGGCAATGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1115s1c1
Sequence:CCGGCCAATTCAAGTGAAGATTATGCTCGAGCATAATCTTCACTTGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004119.1-2392s1c1
Sequence:CCGGGACTTGAATGTGCTTACATTTCTCGAGAAATGTAAGCACATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004119.x-1059s1c1
Sequence:CCGGGCATCCCAGTCAATCAGCTTTCTCGAGAAAGCTGATTGACTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2461s1c1
Sequence:CCGGCTGGAATTTAAGTCGTGTGTTCTCGAGAACACACGACTTAAATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2237s1c1
Sequence:CCGGCCACTTTCCAATCACATCCAACTCGAGTTGGATGTGATTGGAAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2908s1c1
Sequence:CCGGAAGAAGCGATGTATCAGAATCTCGAGATTCTGATACATCGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004119.x-3176s1c1
Sequence:CCGGCGTCTGCGTTTACTCTTGTTTCTCGAGAAACAAGAGTAAACGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-2743s1c1
Sequence:CCGGGCTAACTTCTACAAACTGATTCTCGAGAATCAGTTTGTAGAAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.x-139s1c1
Sequence:CCGGCAAGATCTGCCTGTGATCAAGCTCGAGCTTGATCACAGGCAGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004119.1-1734s1c1
Sequence:CCGGCCTGCTAATTTGTCACAAGTACTCGAGTACTTGTGACAAATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010229
FLT3 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2724s1c1
Sequence:CCGGCGCTAACTTCTATAAACTGATCTCGAGATCAGTTTATAGAAGTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2610s1c1
Sequence:CCGGCGAGAGCTTATTTGAAGGGATCTCGAGATCCCTTCAAATAAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1848s1c1
Sequence:CCGGCCCGAGAGAGAACTTAGAGTTCTCGAGAACTCTAAGTTCTCTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1690s1c1
Sequence:CCGGCCCTTCATTGTTGTTCTCATTCTCGAGAATGAGAACAACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-1712s21c1
Sequence:CCGGGGTGTCGAGCAGTACTCTAAACTCGAGTTTAGAGTACTGCTCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-2109s21c1
Sequence:CCGGACGGCCTATGGCATTAGTAAACTCGAGTTTACTAATGCCATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-727s21c1
Sequence:CCGGTGCTAAGAAGACCTTACTTTACTCGAGTAAAGTAAGGTCTTCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-436s21c1
Sequence:CCGGAGAGTGAAGGGACGGTATATGCTCGAGCATATACCGTCCCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010229
FLT3 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2724s1c1
Sequence:CCGGCGCTAACTTCTATAAACTGATCTCGAGATCAGTTTATAGAAGTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2610s1c1
Sequence:CCGGCGAGAGCTTATTTGAAGGGATCTCGAGATCCCTTCAAATAAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1848s1c1
Sequence:CCGGCCCGAGAGAGAACTTAGAGTTCTCGAGAACTCTAAGTTCTCTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1690s1c1
Sequence:CCGGCCCTTCATTGTTGTTCTCATTCTCGAGAATGAGAACAACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-1712s21c1
Sequence:CCGGGGTGTCGAGCAGTACTCTAAACTCGAGTTTAGAGTACTGCTCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-2109s21c1
Sequence:CCGGACGGCCTATGGCATTAGTAAACTCGAGTTTACTAATGCCATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-727s21c1
Sequence:CCGGTGCTAAGAAGACCTTACTTTACTCGAGTAAAGTAAGGTCTTCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-436s21c1
Sequence:CCGGAGAGTGAAGGGACGGTATATGCTCGAGCATATACCGTCCCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010229
FLT3 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2724s1c1
Sequence:CCGGCGCTAACTTCTATAAACTGATCTCGAGATCAGTTTATAGAAGTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-2610s1c1
Sequence:CCGGCGAGAGCTTATTTGAAGGGATCTCGAGATCCCTTCAAATAAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1848s1c1
Sequence:CCGGCCCGAGAGAGAACTTAGAGTTCTCGAGAACTCTAAGTTCTCTCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010229.1-1690s1c1
Sequence:CCGGCCCTTCATTGTTGTTCTCATTCTCGAGAATGAGAACAACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-1712s21c1
Sequence:CCGGGGTGTCGAGCAGTACTCTAAACTCGAGTTTAGAGTACTGCTCGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-2109s21c1
Sequence:CCGGACGGCCTATGGCATTAGTAAACTCGAGTTTACTAATGCCATAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-727s21c1
Sequence:CCGGTGCTAAGAAGACCTTACTTTACTCGAGTAAAGTAAGGTCTTCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010229.2-436s21c1
Sequence:CCGGAGAGTGAAGGGACGGTATATGCTCGAGCATATACCGTCCCTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks