EMAIL THIS PAGE TO A FRIEND

FLT3LG

fms-related tyrosine kinase 3 ligand

31 Gene Product Result for
Synonyms: FL FLT3L
UniProtKB ID: P49771, A0AVC2, B9EGH2
Gene ID:
Human(2323) Summary: Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]
Rat(100363556) fms-related tyrosine kinase 3 ligand
naked mole-rat(101698597) fms-related tyrosine kinase 3 ligand
domestic guinea pig(100723994) fms-related tyrosine kinase 3 ligand
domestic cat(493796) fms-related tyrosine kinase 3 ligand
cow(282233) fms-related tyrosine kinase 3 ligand
dog(442938) fms-related tyrosine kinase 3 ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077191 MISSION® esiRNA esiRNA human FLT3LG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180507 predicted 770
2 SASI_Hs01_00180508 predicted 193
3 SASI_Hs01_00180509 predicted 689
4 SASI_Hs01_00180510 predicted 778
5 SASI_Hs01_00180511 predicted 782
6 SASI_Hs01_00180512 predicted 770
7 SASI_Hs02_00331898 predicted 393
8 SASI_Hs01_00180514 predicted 514
9 SASI_Hs01_00180515 predicted 331
10 SASI_Hs01_00180516 predicted 388
11 SASI_Hs01_00180513 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001459
VALIDATED
FLT3LG MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 3 ligand
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-866s1c1
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-243s1c1
Sequence:CCGGCCTGCTTCAAGATTACCCAGTCTCGAGACTGGGTAATCTTGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-232s1c1
Sequence:CCGGCTGTCTGACTACCTGCTTCAACTCGAGTTGAAGCAGGTAGTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001459.2-516s1c1
Sequence:CCGGGCCCTGGATCACTCGCCAGAACTCGAGTTCTGGCGAGTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-398s1c1
Sequence:CCGGCGGAGATACACTTTGTCACCACTCGAGTGGTGACAAAGTGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001459.2-866s1c2
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-202s21c1
Sequence:CCGGTCCTCCGACTTCGCTGTCAAACTCGAGTTTGACAGCGAAGTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-173s21c1
Sequence:CCGGAGGACTGCTCCTTCCAACACACTCGAGTGTGTTGGAAGGAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-452s21c1
Sequence:CCGGGCTTCGTCCAGACCAACATCTCTCGAGAGATGTTGGTCTGGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-360s21c1
Sequence:CCGGTGGGTCCAAGATGCAAGGCTTCTCGAGAAGCCTTGCATCTTGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001459
VALIDATED
FLT3LG MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 3 ligand
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-866s1c1
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-243s1c1
Sequence:CCGGCCTGCTTCAAGATTACCCAGTCTCGAGACTGGGTAATCTTGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-232s1c1
Sequence:CCGGCTGTCTGACTACCTGCTTCAACTCGAGTTGAAGCAGGTAGTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001459.2-516s1c1
Sequence:CCGGGCCCTGGATCACTCGCCAGAACTCGAGTTCTGGCGAGTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-398s1c1
Sequence:CCGGCGGAGATACACTTTGTCACCACTCGAGTGGTGACAAAGTGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001459.2-866s1c2
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-202s21c1
Sequence:CCGGTCCTCCGACTTCGCTGTCAAACTCGAGTTTGACAGCGAAGTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-173s21c1
Sequence:CCGGAGGACTGCTCCTTCCAACACACTCGAGTGTGTTGGAAGGAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-452s21c1
Sequence:CCGGGCTTCGTCCAGACCAACATCTCTCGAGAGATGTTGGTCTGGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-360s21c1
Sequence:CCGGTGGGTCCAAGATGCAAGGCTTCTCGAGAAGCCTTGCATCTTGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001459
VALIDATED
FLT3LG MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 3 ligand
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-866s1c1
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-243s1c1
Sequence:CCGGCCTGCTTCAAGATTACCCAGTCTCGAGACTGGGTAATCTTGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-232s1c1
Sequence:CCGGCTGTCTGACTACCTGCTTCAACTCGAGTTGAAGCAGGTAGTCAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001459.2-516s1c1
Sequence:CCGGGCCCTGGATCACTCGCCAGAACTCGAGTTCTGGCGAGTGATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001459.2-398s1c1
Sequence:CCGGCGGAGATACACTTTGTCACCACTCGAGTGGTGACAAAGTGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001459.2-866s1c2
Sequence:CCGGCATAGCCTGGACACAGAGGAACTCGAGTTCCTCTGTGTCCAGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-202s21c1
Sequence:CCGGTCCTCCGACTTCGCTGTCAAACTCGAGTTTGACAGCGAAGTCGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-173s21c1
Sequence:CCGGAGGACTGCTCCTTCCAACACACTCGAGTGTGTTGGAAGGAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-452s21c1
Sequence:CCGGGCTTCGTCCAGACCAACATCTCTCGAGAGATGTTGGTCTGGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001459.2-360s21c1
Sequence:CCGGTGGGTCCAAGATGCAAGGCTTCTCGAGAAGCCTTGCATCTTGGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks