EMAIL THIS PAGE TO A FRIEND

FLT4

fms-related tyrosine kinase 4

124 Gene Product Result for
Synonyms: FLT41 LMPH1A PCL VEGFR3
UniProtKB ID: P35916, A8K6L4, B5A926, Q16067, Q86W07, Q86W08
Gene ID:
Human(2324) Summary: This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
Mouse(14257) FMS-like tyrosine kinase 4
Rat(114110) fms-related tyrosine kinase 4
Zebrafish(30121) fms-related tyrosine kinase 4
cow(338031) fms-related tyrosine kinase 4
domestic cat(101094727) fms-related tyrosine kinase 4
chicken(395742) fms-related tyrosine kinase 4
dog(481464) fms-related tyrosine kinase 4
domestic guinea pig(100715831) fms-related tyrosine kinase 4
naked mole-rat(101702013) fms-related tyrosine kinase 4
sheep(101117247) fms-related tyrosine kinase 4
Domestic Rabbit(100008829) fms-related tyrosine kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143641 MISSION® esiRNA esiRNA human FLT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002020 Rosetta Predictions human pricing
NM_182925 Rosetta Predictions human pricing
NM_053652 Rosetta Predictions rat pricing
NM_008029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049215 predicted 3197
2 SASI_Hs02_00333031 predicted 1603
3 SASI_Hs01_00049217 predicted 1898
4 SASI_Hs01_00049219 predicted 3166
5 SASI_Hs01_00049220 predicted 472
6 SASI_Hs02_00333032 predicted 841
7 SASI_Hs02_00333033 predicted 1714
8 SASI_Hs02_00333034 predicted 2025
9 SASI_Hs02_00333035 predicted 3326
10 SASI_Hs02_00333036 predicted 3558
11 SASI_Hs01_00049216 predicted 3149
12 SASI_Hs01_00049218 predicted 1593
13 SASI_Hs01_00049221 predicted 403
14 SASI_Hs01_00049222 predicted 1225
15 SASI_Hs01_00049223 predicted 464
16 SASI_Hs01_00049224 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033812 predicted 3193
2 SASI_Hs02_00371054 predicted 1602
3 SASI_Hs01_00033814 predicted 1899
4 SASI_Hs01_00033816 predicted 3162
5 SASI_Hs01_00033817 predicted 470
6 SASI_Hs02_00371055 predicted 847
7 SASI_Hs02_00371056 predicted 1706
8 SASI_Hs02_00371057 predicted 2020
9 SASI_Hs02_00371058 predicted 3327
10 SASI_Hs02_00371059 predicted 3558
11 SASI_Hs01_00033813 predicted 3097
12 SASI_Hs01_00033815 predicted 1532
13 SASI_Hs01_00033818 predicted 347
14 SASI_Hs01_00033819 predicted 1158
15 SASI_Hs01_00033820 predicted 401
16 SASI_Hs01_00033821 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107878 predicted 2115
2 SASI_Rn01_00107879 predicted 3134
3 SASI_Rn01_00107880 predicted 817
4 SASI_Rn01_00107881 predicted 1735
5 SASI_Rn02_00266374 predicted 1824
6 SASI_Rn01_00107882 predicted 3372
7 SASI_Rn01_00107883 predicted 3189
8 SASI_Rn01_00107884 predicted 2460
9 SASI_Rn01_00107885 predicted 2107
10 SASI_Rn02_00266375 predicted 2617
11 SASI_Rn01_00107877 predicted 931
12 SASI_Rn01_00107886 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176740 predicted 1980
2 SASI_Mm01_00176741 predicted 3171
3 SASI_Mm01_00176742 predicted 2159
4 SASI_Mm02_00312985 predicted 3785
5 SASI_Mm01_00176743 predicted 420
6 SASI_Mm01_00176744 predicted 979
7 SASI_Mm01_00176745 predicted 2852
8 SASI_Mm01_00176746 predicted 3291
9 SASI_Mm01_00176748 predicted 4204
10 SASI_Mm01_00176749 predicted 803
11 SASI_Mm01_00176747 predicted 2514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002020
VALIDATED
FLT4 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-2548s21c1
Sequence:GTACCGGTCTGGAGGAGCAATGCGAATACTCGAGTATTCGCATTGCTCCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002020.4-3995s21c1
Sequence:CCGGAGGCAGCATACGTCAGCATTTCTCGAGAAATGCTGACGTATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1017s21c1
Sequence:CCGGACAACGGCATCCAGCGATTTCCTCGAGGAAATCGCTGGATGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002020.4-835s21c1
Sequence:CCGGCACCGTGTGGGCTGAGTTTAACTCGAGTTAAACTCAGCCCACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-750s21c1
Sequence:CCGGTCACAGGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1467s21c1
Sequence:CCGGGGACACCCTGCAAGATGTTTGCTCGAGCAAACATCTTGCAGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-3891s1c1
Sequence:CCGGGCATAGACAAGAAAGCGGCTTCTCGAGAAGCCGCTTTCTTGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4001s1c1
Sequence:CCGGCGCTATTTCTTCTACTGCTATCTCGAGATAGCAGTAGAAGAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-3989s1c1
Sequence:CCGGCTTTAAGACTTTCGCTATTTCCTCGAGGAAATAGCGAAAGTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4258s1c1
Sequence:CCGGGCGTTACTGCTTGACCAAAGACTCGAGTCTTTGGTCAAGCAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-1686s1c1
Sequence:CCGGCGACGGCTTCACCATCGAATCCTCGAGGATTCGATGGTGAAGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002020.x-2796s1c1
Sequence:CCGGGATCGTGGAGTTCTGCAAGTACTCGAGTACTTGCAGAACTCCACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-2503s1c1
Sequence:CCGGTGCGAATACCTGTCCTACGATCTCGAGATCGTAGGACAGGTATTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-1694s1c1
Sequence:CCGGTCACCATCGAATCCAAGCCATCTCGAGATGGCTTGGATTCGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002020
VALIDATED
FLT4 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-2548s21c1
Sequence:GTACCGGTCTGGAGGAGCAATGCGAATACTCGAGTATTCGCATTGCTCCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002020.4-3995s21c1
Sequence:CCGGAGGCAGCATACGTCAGCATTTCTCGAGAAATGCTGACGTATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1017s21c1
Sequence:CCGGACAACGGCATCCAGCGATTTCCTCGAGGAAATCGCTGGATGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002020.4-835s21c1
Sequence:CCGGCACCGTGTGGGCTGAGTTTAACTCGAGTTAAACTCAGCCCACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-750s21c1
Sequence:CCGGTCACAGGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1467s21c1
Sequence:CCGGGGACACCCTGCAAGATGTTTGCTCGAGCAAACATCTTGCAGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-3891s1c1
Sequence:CCGGGCATAGACAAGAAAGCGGCTTCTCGAGAAGCCGCTTTCTTGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4001s1c1
Sequence:CCGGCGCTATTTCTTCTACTGCTATCTCGAGATAGCAGTAGAAGAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-3989s1c1
Sequence:CCGGCTTTAAGACTTTCGCTATTTCCTCGAGGAAATAGCGAAAGTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4258s1c1
Sequence:CCGGGCGTTACTGCTTGACCAAAGACTCGAGTCTTTGGTCAAGCAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-1686s1c1
Sequence:CCGGCGACGGCTTCACCATCGAATCCTCGAGGATTCGATGGTGAAGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002020.x-2796s1c1
Sequence:CCGGGATCGTGGAGTTCTGCAAGTACTCGAGTACTTGCAGAACTCCACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-2503s1c1
Sequence:CCGGTGCGAATACCTGTCCTACGATCTCGAGATCGTAGGACAGGTATTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-1694s1c1
Sequence:CCGGTCACCATCGAATCCAAGCCATCTCGAGATGGCTTGGATTCGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002020
VALIDATED
FLT4 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-2548s21c1
Sequence:GTACCGGTCTGGAGGAGCAATGCGAATACTCGAGTATTCGCATTGCTCCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002020.4-3995s21c1
Sequence:CCGGAGGCAGCATACGTCAGCATTTCTCGAGAAATGCTGACGTATGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1017s21c1
Sequence:CCGGACAACGGCATCCAGCGATTTCCTCGAGGAAATCGCTGGATGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002020.4-835s21c1
Sequence:CCGGCACCGTGTGGGCTGAGTTTAACTCGAGTTAAACTCAGCCCACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-750s21c1
Sequence:CCGGTCACAGGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002020.4-1467s21c1
Sequence:CCGGGGACACCCTGCAAGATGTTTGCTCGAGCAAACATCTTGCAGGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-3891s1c1
Sequence:CCGGGCATAGACAAGAAAGCGGCTTCTCGAGAAGCCGCTTTCTTGTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4001s1c1
Sequence:CCGGCGCTATTTCTTCTACTGCTATCTCGAGATAGCAGTAGAAGAAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-3989s1c1
Sequence:CCGGCTTTAAGACTTTCGCTATTTCCTCGAGGAAATAGCGAAAGTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002020.1-4258s1c1
Sequence:CCGGGCGTTACTGCTTGACCAAAGACTCGAGTCTTTGGTCAAGCAGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.1-1686s1c1
Sequence:CCGGCGACGGCTTCACCATCGAATCCTCGAGGATTCGATGGTGAAGCCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002020.x-2796s1c1
Sequence:CCGGGATCGTGGAGTTCTGCAAGTACTCGAGTACTTGCAGAACTCCACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-2503s1c1
Sequence:CCGGTGCGAATACCTGTCCTACGATCTCGAGATCGTAGGACAGGTATTCGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002020.x-1694s1c1
Sequence:CCGGTCACCATCGAATCCAAGCCATCTCGAGATGGCTTGGATTCGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008029
VALIDATED
FLT4 MISSION shRNA Bacterial Glycerol Stock
fms-related tyrosine kinase 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-3887s21c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-2161s21c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-4460s21c1
Sequence:CCGGTGGGCGACAGGGTTCTCATAACTCGAGTTATGAGAACCCTGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2773s21c1
Sequence:CCGGGTCGGAGCTCAAGATCCTAATCTCGAGATTAGGATCTTGAGCTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2344s21c1
Sequence:CCGGCAATGCCAAGGGCTGCGTAAACTCGAGTTTACGCAGCCCTTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-3715s21c1
Sequence:CCGGCAGCCTGGCAGCCAGATATTACTCGAGTAATATCTGGCTGCCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-4475s21c1
Sequence:CCGGATTCTTCTCCAGCACCTATTTCTCGAGAAATAGGTGCTGGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-421s1c1
Sequence:CCGGCCAGCACCTATGTGTTTGTAACTCGAGTTACAAACACATAGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-2162s1c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008029.1-1667s1c1
Sequence:CCGGCCAGGATGAGAGACTCATCTACTCGAGTAGATGAGTCTCTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3888s1c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3165s1c1
Sequence:CCGGCGGAACATCCTACTGTCAGAACTCGAGTTCTGACAGTAGGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008029
VALIDATED
FLT4 MISSION shRNA shRNA Plasmid DNA
fms-related tyrosine kinase 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-3887s21c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-2161s21c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-4460s21c1
Sequence:CCGGTGGGCGACAGGGTTCTCATAACTCGAGTTATGAGAACCCTGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2773s21c1
Sequence:CCGGGTCGGAGCTCAAGATCCTAATCTCGAGATTAGGATCTTGAGCTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2344s21c1
Sequence:CCGGCAATGCCAAGGGCTGCGTAAACTCGAGTTTACGCAGCCCTTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-3715s21c1
Sequence:CCGGCAGCCTGGCAGCCAGATATTACTCGAGTAATATCTGGCTGCCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-4475s21c1
Sequence:CCGGATTCTTCTCCAGCACCTATTTCTCGAGAAATAGGTGCTGGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-421s1c1
Sequence:CCGGCCAGCACCTATGTGTTTGTAACTCGAGTTACAAACACATAGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-2162s1c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008029.1-1667s1c1
Sequence:CCGGCCAGGATGAGAGACTCATCTACTCGAGTAGATGAGTCTCTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3888s1c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3165s1c1
Sequence:CCGGCGGAACATCCTACTGTCAGAACTCGAGTTCTGACAGTAGGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008029
VALIDATED
FLT4 MISSION shRNA Lentiviral Transduction Particles
fms-related tyrosine kinase 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-3887s21c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008029.2-2161s21c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-4460s21c1
Sequence:CCGGTGGGCGACAGGGTTCTCATAACTCGAGTTATGAGAACCCTGTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2773s21c1
Sequence:CCGGGTCGGAGCTCAAGATCCTAATCTCGAGATTAGGATCTTGAGCTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-2344s21c1
Sequence:CCGGCAATGCCAAGGGCTGCGTAAACTCGAGTTTACGCAGCCCTTGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.2-3715s21c1
Sequence:CCGGCAGCCTGGCAGCCAGATATTACTCGAGTAATATCTGGCTGCCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008029.3-4475s21c1
Sequence:CCGGATTCTTCTCCAGCACCTATTTCTCGAGAAATAGGTGCTGGAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-421s1c1
Sequence:CCGGCCAGCACCTATGTGTTTGTAACTCGAGTTACAAACACATAGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-2162s1c1
Sequence:CCGGGCCCAGTATTGTGTGGTACAACTCGAGTTGTACCACACAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008029.1-1667s1c1
Sequence:CCGGCCAGGATGAGAGACTCATCTACTCGAGTAGATGAGTCTCTCATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3888s1c1
Sequence:CCGGGAAGAGTTTGAGGAGCTAGAACTCGAGTTCTAGCTCCTCAAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008029.1-3165s1c1
Sequence:CCGGCGGAACATCCTACTGTCAGAACTCGAGTTCTGACAGTAGGATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks