EMAIL THIS PAGE TO A FRIEND

FLVCR1

feline leukemia virus subgroup C cellular receptor 1

26 Gene Product Result for
Synonyms: AXPC1 FLVCR MFSD7B PCA PCARP
UniProtKB ID: Q9Y5Y0, Q1HE16, Q86XY9, Q9NVR9
Gene ID:
Human(28982) Summary: This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein is a heme transporter that may play a critical role in erythropoiesis by protecting developing erythroid cells from heme toxicity. This gene may play a role in posterior column ataxia with retinitis pigmentosa and the hematological disorder Diamond-Blackfan syndrome. [provided by RefSeq, Jan 2011]
Zebrafish(562595) feline leukemia virus subgroup C cellular receptor 1
dog(490285) feline leukemia virus subgroup C cellular receptor 1
domestic cat(493854) feline leukemia virus subgroup C cellular receptor 1
cow(533317) feline leukemia virus subgroup C cellular receptor 1
Horse(100050536) feline leukemia virus subgroup C cellular receptor 1
chicken(421365) feline leukemia virus subgroup C cellular receptor 1
sheep(101103169) feline leukemia virus subgroup C cellular receptor 1
Domestic Rabbit(100358453) feline leukemia virus subgroup C cellular receptor 1
naked mole-rat(101715114) feline leukemia virus subgroup C cellular receptor 1
domestic guinea pig(100720993) feline leukemia virus subgroup C cellular receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014053 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017851 MISSION® esiRNA esiRNA targeting human FLVCR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014053 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015877 predicted 1445
2 SASI_Hs02_00345065 predicted 978
3 SASI_Hs01_00015878 predicted 1662
4 SASI_Hs01_00015879 predicted 1550
5 SASI_Hs01_00015880 predicted 1327
6 SASI_Hs02_00345066 predicted 1699
7 SASI_Hs01_00015882 predicted 1359
8 SASI_Hs01_00015884 predicted 1200
9 SASI_Hs02_00345067 predicted 1692
10 SASI_Hs01_00015886 predicted 1141
11 SASI_Hs01_00015881 predicted 1272
12 SASI_Hs01_00015883 predicted 1461
13 SASI_Hs01_00015885 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014053
VALIDATED
FLVCR1 MISSION shRNA Bacterial Glycerol Stock
feline leukemia virus subgroup C cellular receptor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1143s1c1
Sequence:CCGGCCCTGAAGAGTACTCCTATAACTCGAGTTATAGGAGTACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-576s1c1
Sequence:CCGGCCAGTACAGCATCATTAGCAACTCGAGTTGCTAATGATGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-252s1c1
Sequence:CCGGCGCGAAAGGATACCTCCCGTTCTCGAGAACGGGAGGTATCCTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-1650s1c1
Sequence:CCGGCACATCAGACTATGGTCCTAACTCGAGTTAGGACCATAGTCTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1741s1c1
Sequence:CCGGCTGCGAAGACACAACATAAATCTCGAGATTTATGTTGTGTCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1244s21c1
Sequence:CCGGATTCAGTCTCAACGTTATTAACTCGAGTTAATAACGTTGAGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1397s21c1
Sequence:CCGGAGACTACTCTGATAGTTTATACTCGAGTATAAACTATCAGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2135s21c1
Sequence:CCGGAGTAAGCTTCTTGACGTTTACCTCGAGGTAAACGTCAAGAAGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1844s21c1
Sequence:CCGGAGCAGTCAGAATCAGCAATTTCTCGAGAAATTGCTGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2284s21c1
Sequence:CCGGAGTGGAACTAAATGTACAATACTCGAGTATTGTACATTTAGTTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-997s21c1
Sequence:CCGGACAAATCTCCTGGCTTGTAATCTCGAGATTACAAGCCAGGAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1698s21c1
Sequence:CCGGGATGTTTATAGGCATCATATTCTCGAGAATATGATGCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014053
VALIDATED
FLVCR1 MISSION shRNA shRNA Plasmid DNA
feline leukemia virus subgroup C cellular receptor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1143s1c1
Sequence:CCGGCCCTGAAGAGTACTCCTATAACTCGAGTTATAGGAGTACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-576s1c1
Sequence:CCGGCCAGTACAGCATCATTAGCAACTCGAGTTGCTAATGATGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-252s1c1
Sequence:CCGGCGCGAAAGGATACCTCCCGTTCTCGAGAACGGGAGGTATCCTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-1650s1c1
Sequence:CCGGCACATCAGACTATGGTCCTAACTCGAGTTAGGACCATAGTCTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1741s1c1
Sequence:CCGGCTGCGAAGACACAACATAAATCTCGAGATTTATGTTGTGTCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1244s21c1
Sequence:CCGGATTCAGTCTCAACGTTATTAACTCGAGTTAATAACGTTGAGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1397s21c1
Sequence:CCGGAGACTACTCTGATAGTTTATACTCGAGTATAAACTATCAGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2135s21c1
Sequence:CCGGAGTAAGCTTCTTGACGTTTACCTCGAGGTAAACGTCAAGAAGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1844s21c1
Sequence:CCGGAGCAGTCAGAATCAGCAATTTCTCGAGAAATTGCTGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2284s21c1
Sequence:CCGGAGTGGAACTAAATGTACAATACTCGAGTATTGTACATTTAGTTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-997s21c1
Sequence:CCGGACAAATCTCCTGGCTTGTAATCTCGAGATTACAAGCCAGGAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1698s21c1
Sequence:CCGGGATGTTTATAGGCATCATATTCTCGAGAATATGATGCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014053
VALIDATED
FLVCR1 MISSION shRNA Lentiviral Transduction Particles
feline leukemia virus subgroup C cellular receptor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1143s1c1
Sequence:CCGGCCCTGAAGAGTACTCCTATAACTCGAGTTATAGGAGTACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-576s1c1
Sequence:CCGGCCAGTACAGCATCATTAGCAACTCGAGTTGCTAATGATGCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-252s1c1
Sequence:CCGGCGCGAAAGGATACCTCCCGTTCTCGAGAACGGGAGGTATCCTTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014053.1-1650s1c1
Sequence:CCGGCACATCAGACTATGGTCCTAACTCGAGTTAGGACCATAGTCTGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014053.1-1741s1c1
Sequence:CCGGCTGCGAAGACACAACATAAATCTCGAGATTTATGTTGTGTCTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1244s21c1
Sequence:CCGGATTCAGTCTCAACGTTATTAACTCGAGTTAATAACGTTGAGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1397s21c1
Sequence:CCGGAGACTACTCTGATAGTTTATACTCGAGTATAAACTATCAGAGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2135s21c1
Sequence:CCGGAGTAAGCTTCTTGACGTTTACCTCGAGGTAAACGTCAAGAAGCTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1844s21c1
Sequence:CCGGAGCAGTCAGAATCAGCAATTTCTCGAGAAATTGCTGATTCTGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014053.2-2284s21c1
Sequence:CCGGAGTGGAACTAAATGTACAATACTCGAGTATTGTACATTTAGTTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-997s21c1
Sequence:CCGGACAAATCTCCTGGCTTGTAATCTCGAGATTACAAGCCAGGAGATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014053.2-1698s21c1
Sequence:CCGGGATGTTTATAGGCATCATATTCTCGAGAATATGATGCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks