EMAIL THIS PAGE TO A FRIEND

FLVCR2

feline leukemia virus subgroup C cellular receptor family, member 2

48 Gene Product Result for
Synonyms: C14orf58 CCT EPV FLVCRL14q MFSD7C PVHH
UniProtKB ID: Q9UPI3, B7Z485, Q53ZT9, Q96JY3, Q9NX90
Gene ID:
Human(55640) Summary: This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Rat(314323) feline leukemia virus subgroup C cellular receptor family, member 2
Zebrafish(565210) feline leukemia virus subgroup C cellular receptor family, member 2
cow(781116) feline leukemia virus subgroup C cellular receptor family, member 2
domestic cat(101084034) feline leukemia virus subgroup C cellular receptor family, member 2
dog(490795) feline leukemia virus subgroup C cellular receptor family, member 2
cow(507318) feline leukemia virus subgroup C cellular receptor family, member 2
chicken(423365) feline leukemia virus subgroup C cellular receptor family, member 2
domestic guinea pig(100724765) feline leukemia virus subgroup C cellular receptor family, member 2
naked mole-rat(101715843) feline leukemia virus subgroup C cellular receptor family, member 2
sheep(101108756) feline leukemia virus subgroup C cellular receptor family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017791 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016021 MISSION® esiRNA esiRNA targeting human FLVCR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017791 Rosetta Predictions human pricing
NM_199109 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042002 predicted 1641
2 SASI_Hs01_00042003 predicted 1440
3 SASI_Hs01_00042005 predicted 1128
4 SASI_Hs02_00350656 predicted 1002
5 SASI_Hs01_00042007 predicted 1062
6 SASI_Hs01_00042008 predicted 1658
7 SASI_Hs01_00042009 predicted 1558
8 SASI_Hs02_00350657 predicted 1003
9 SASI_Hs01_00042010 predicted 1570
10 SASI_Hs01_00042011 predicted 1820
11 SASI_Hs01_00042004 predicted 1076
12 SASI_Hs01_00042006 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119612 predicted 1221
2 SASI_Rn01_00119613 predicted 1012
3 SASI_Rn01_00119614 predicted 1468
4 SASI_Rn01_00119615 predicted 1001
5 SASI_Rn01_00119616 predicted 1745
6 SASI_Rn01_00119617 predicted 1385
7 SASI_Rn02_00270129 predicted 661
8 SASI_Rn01_00119618 predicted 1589
9 SASI_Rn01_00119619 predicted 541
10 SASI_Rn01_00119620 predicted 1276
11 SASI_Rn01_00119621 predicted 1975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017791
FLVCR2 MISSION shRNA Bacterial Glycerol Stock
feline leukemia virus subgroup C cellular receptor family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1504s21c1
Sequence:CCGGGACAACCCTGGTAGTCTATATCTCGAGATATAGACTACCAGGGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2059s21c1
Sequence:CCGGGGGAATCAGTGGGACTATTTGCTCGAGCAAATAGTCCCACTGATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1422s21c1
Sequence:CCGGTTGGCCTGACGATCGTCATTGCTCGAGCAATGACGATCGTCAGGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2111s21c1
Sequence:CCGGACGTAAGAGCTTGGATGATTTCTCGAGAAATCATCCAAGCTCTTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1704s21c1
Sequence:CCGGACATATCTGCACAGGTATTTGCTCGAGCAAATACCTGTGCAGATATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-993s1c1
Sequence:CCGGGCTTGGAATTGCGATTGGGTTCTCGAGAACCCAATCGCAATTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-1122s1c1
Sequence:CCGGCCTTGTCATCATTGTGTTCAACTCGAGTTGAACACAATGATGACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017791.1-2741s1c1
Sequence:CCGGGCCTTTATCTTGATGTTGCATCTCGAGATGCAACATCAAGATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-639s1c1
Sequence:CCGGCGGCTCCATCAATAACATCTTCTCGAGAAGATGTTATTGATGGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-612s1c1
Sequence:CCGGGTGCAACTCCTTTCAGTGGATCTCGAGATCCACTGAAAGGAGTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017791
FLVCR2 MISSION shRNA shRNA Plasmid DNA
feline leukemia virus subgroup C cellular receptor family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1504s21c1
Sequence:CCGGGACAACCCTGGTAGTCTATATCTCGAGATATAGACTACCAGGGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2059s21c1
Sequence:CCGGGGGAATCAGTGGGACTATTTGCTCGAGCAAATAGTCCCACTGATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1422s21c1
Sequence:CCGGTTGGCCTGACGATCGTCATTGCTCGAGCAATGACGATCGTCAGGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2111s21c1
Sequence:CCGGACGTAAGAGCTTGGATGATTTCTCGAGAAATCATCCAAGCTCTTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1704s21c1
Sequence:CCGGACATATCTGCACAGGTATTTGCTCGAGCAAATACCTGTGCAGATATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-993s1c1
Sequence:CCGGGCTTGGAATTGCGATTGGGTTCTCGAGAACCCAATCGCAATTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-1122s1c1
Sequence:CCGGCCTTGTCATCATTGTGTTCAACTCGAGTTGAACACAATGATGACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017791.1-2741s1c1
Sequence:CCGGGCCTTTATCTTGATGTTGCATCTCGAGATGCAACATCAAGATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-639s1c1
Sequence:CCGGCGGCTCCATCAATAACATCTTCTCGAGAAGATGTTATTGATGGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-612s1c1
Sequence:CCGGGTGCAACTCCTTTCAGTGGATCTCGAGATCCACTGAAAGGAGTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017791
FLVCR2 MISSION shRNA Lentiviral Transduction Particles
feline leukemia virus subgroup C cellular receptor family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1504s21c1
Sequence:CCGGGACAACCCTGGTAGTCTATATCTCGAGATATAGACTACCAGGGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2059s21c1
Sequence:CCGGGGGAATCAGTGGGACTATTTGCTCGAGCAAATAGTCCCACTGATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1422s21c1
Sequence:CCGGTTGGCCTGACGATCGTCATTGCTCGAGCAATGACGATCGTCAGGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017791.2-2111s21c1
Sequence:CCGGACGTAAGAGCTTGGATGATTTCTCGAGAAATCATCCAAGCTCTTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017791.2-1704s21c1
Sequence:CCGGACATATCTGCACAGGTATTTGCTCGAGCAAATACCTGTGCAGATATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-993s1c1
Sequence:CCGGGCTTGGAATTGCGATTGGGTTCTCGAGAACCCAATCGCAATTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-1122s1c1
Sequence:CCGGCCTTGTCATCATTGTGTTCAACTCGAGTTGAACACAATGATGACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017791.1-2741s1c1
Sequence:CCGGGCCTTTATCTTGATGTTGCATCTCGAGATGCAACATCAAGATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-639s1c1
Sequence:CCGGCGGCTCCATCAATAACATCTTCTCGAGAAGATGTTATTGATGGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017791.1-612s1c1
Sequence:CCGGGTGCAACTCCTTTCAGTGGATCTCGAGATCCACTGAAAGGAGTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)