EMAIL THIS PAGE TO A FRIEND

FLYWCH1

FLYWCH-type zinc finger 1

70 Gene Product Result for
Gene ID:
Mouse(224613) FLYWCH-type zinc finger 1
Rat(360488) FLYWCH-type zinc finger 1
sheep(101119011) FLYWCH-type zinc finger 1
naked mole-rat(101719469) FLYWCH-type zinc finger 1
domestic guinea pig(100714254) FLYWCH-type zinc finger 1
domestic cat(101098916) FLYWCH-type zinc finger 1
cow(531821) FLYWCH-type zinc finger 1
dog(490052) FLYWCH-type zinc finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020912 Rosetta Predictions human pricing
NM_032296 Rosetta Predictions human pricing
XM_001056224 Rosetta Predictions rat pricing
XM_340760 Rosetta Predictions rat pricing
NM_153791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180872 predicted 638
2 SASI_Hs01_00180873 predicted 1195
3 SASI_Hs01_00180874 predicted 1903
4 SASI_Hs01_00180875 predicted 2178
5 SASI_Hs01_00180876 predicted 589
6 SASI_Hs01_00180877 predicted 1522
7 SASI_Hs01_00180878 predicted 1354
8 SASI_Hs01_00180879 predicted 538
9 SASI_Hs01_00180880 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101196 predicted 644
2 SASI_Hs01_00101197 predicted 1193
3 SASI_Hs01_00101198 predicted 1903
4 SASI_Hs01_00101199 predicted 2173
5 SASI_Hs01_00101200 predicted 589
6 SASI_Hs01_00101201 predicted 1528
7 SASI_Hs01_00101202 predicted 1349
8 SASI_Hs01_00101203 predicted 539
9 SASI_Hs01_00101204 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282508 predicted 1648
2 SASI_Rn02_00282509 predicted 1041
3 SASI_Rn02_00282510 predicted 1134
4 SASI_Rn02_00282511 predicted 360
5 SASI_Rn02_00282512 predicted 1499
6 SASI_Rn02_00282513 predicted 1636
7 SASI_Rn02_00282514 predicted 843
8 SASI_Rn02_00282515 predicted 1334
9 SASI_Rn02_00282516 predicted 1793
10 SASI_Rn02_00282517 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391859 predicted 1746
2 SASI_Rn02_00391860 predicted 1134
3 SASI_Rn02_00391861 predicted 1228
4 SASI_Rn02_00391862 predicted 1593
5 SASI_Rn02_00391863 predicted 479
6 SASI_Rn02_00391864 predicted 1737
7 SASI_Rn02_00391865 predicted 942
8 SASI_Rn02_00391866 predicted 399
9 SASI_Rn02_00391867 predicted 487
10 SASI_Rn02_00391868 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059130 predicted 1986
2 SASI_Mm01_00059132 predicted 628
3 SASI_Mm01_00059133 predicted 1112
4 SASI_Mm01_00059134 predicted 1241
5 SASI_Mm01_00059135 predicted 1941
6 SASI_Mm01_00059136 predicted 772
7 SASI_Mm01_00059137 predicted 763
8 SASI_Mm01_00059138 predicted 1215
9 SASI_Mm01_00059139 predicted 740
10 SASI_Mm02_00343522 predicted 2231
11 SASI_Mm01_00059131 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032296
FLYWCH1 MISSION shRNA Bacterial Glycerol Stock
FLYWCH-type zinc finger 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4591s1c1
Sequence:CCGGGATTCTCCAATGGACGTGAATCTCGAGATTCACGTCCATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2449s1c1
Sequence:CCGGCCTGAAAGCCAGCAGATTTATCTCGAGATAAATCTGCTGGCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4597s1c1
Sequence:CCGGCCAATGGACGTGAATTTAGATCTCGAGATCTAAATTCACGTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2415s1c1
Sequence:CCGGGATTCAAGTTCAGCTGTGCTTCTCGAGAAGCACAGCTGAACTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-750s1c1
Sequence:CCGGCTTCCTGTACAAGCAGGAGAACTCGAGTTCTCCTGCTTGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4452s1c1
Sequence:CCGGGAGGCGAATCAGAGGAAGAATCTCGAGATTCTTCCTCTGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-3877s1c1
Sequence:CCGGGATGCTCTGTTCTCGCCATTACTCGAGTAATGGCGAGAACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-648s1c1
Sequence:CCGGCCTAGAGATGCCTGAACAGAACTCGAGTTCTGTTCAGGCATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032296.2-4758s1c1
Sequence:CCGGCCAGTCACTGTCACAGAGTTACTCGAGTAACTCTGTGACAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2433s1c1
Sequence:CCGGCTTCAAGACGTGTTCTCCTGACTCGAGTCAGGAGAACACGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4175s1c1
Sequence:CCGGCGAGGAAGGTACTTGCTGAAACTCGAGTTTCAGCAAGTACCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032296
FLYWCH1 MISSION shRNA shRNA Plasmid DNA
FLYWCH-type zinc finger 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4591s1c1
Sequence:CCGGGATTCTCCAATGGACGTGAATCTCGAGATTCACGTCCATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2449s1c1
Sequence:CCGGCCTGAAAGCCAGCAGATTTATCTCGAGATAAATCTGCTGGCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4597s1c1
Sequence:CCGGCCAATGGACGTGAATTTAGATCTCGAGATCTAAATTCACGTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2415s1c1
Sequence:CCGGGATTCAAGTTCAGCTGTGCTTCTCGAGAAGCACAGCTGAACTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-750s1c1
Sequence:CCGGCTTCCTGTACAAGCAGGAGAACTCGAGTTCTCCTGCTTGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4452s1c1
Sequence:CCGGGAGGCGAATCAGAGGAAGAATCTCGAGATTCTTCCTCTGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-3877s1c1
Sequence:CCGGGATGCTCTGTTCTCGCCATTACTCGAGTAATGGCGAGAACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-648s1c1
Sequence:CCGGCCTAGAGATGCCTGAACAGAACTCGAGTTCTGTTCAGGCATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032296.2-4758s1c1
Sequence:CCGGCCAGTCACTGTCACAGAGTTACTCGAGTAACTCTGTGACAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2433s1c1
Sequence:CCGGCTTCAAGACGTGTTCTCCTGACTCGAGTCAGGAGAACACGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4175s1c1
Sequence:CCGGCGAGGAAGGTACTTGCTGAAACTCGAGTTTCAGCAAGTACCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032296
FLYWCH1 MISSION shRNA Lentiviral Transduction Particles
FLYWCH-type zinc finger 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4591s1c1
Sequence:CCGGGATTCTCCAATGGACGTGAATCTCGAGATTCACGTCCATTGGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2449s1c1
Sequence:CCGGCCTGAAAGCCAGCAGATTTATCTCGAGATAAATCTGCTGGCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4597s1c1
Sequence:CCGGCCAATGGACGTGAATTTAGATCTCGAGATCTAAATTCACGTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2415s1c1
Sequence:CCGGGATTCAAGTTCAGCTGTGCTTCTCGAGAAGCACAGCTGAACTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-750s1c1
Sequence:CCGGCTTCCTGTACAAGCAGGAGAACTCGAGTTCTCCTGCTTGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4452s1c1
Sequence:CCGGGAGGCGAATCAGAGGAAGAATCTCGAGATTCTTCCTCTGATTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-3877s1c1
Sequence:CCGGGATGCTCTGTTCTCGCCATTACTCGAGTAATGGCGAGAACAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-648s1c1
Sequence:CCGGCCTAGAGATGCCTGAACAGAACTCGAGTTCTGTTCAGGCATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032296.2-4758s1c1
Sequence:CCGGCCAGTCACTGTCACAGAGTTACTCGAGTAACTCTGTGACAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032296.2-2433s1c1
Sequence:CCGGCTTCAAGACGTGTTCTCCTGACTCGAGTCAGGAGAACACGTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032296.2-4175s1c1
Sequence:CCGGCGAGGAAGGTACTTGCTGAAACTCGAGTTTCAGCAAGTACCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153791
VALIDATED
FLYWCH1 MISSION shRNA Bacterial Glycerol Stock
FLYWCH-type zinc finger 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-788s1c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153791.1-2615s1c1
Sequence:CCGGCAGAACCTTTGCCTCTCATTTCTCGAGAAATGAGAGGCAAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-1085s1c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153791.1-1259s1c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1259s21c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-763s21c1
Sequence:CCGGCAAGAAGCAAGGACGGATAATCTCGAGATTATCCGTCCTTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153791.1-2643s21c1
Sequence:CCGGTCCCTTCCCATTGCCATGAAACTCGAGTTTCATGGCAATGGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-788s21c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1085s21c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153791
VALIDATED
FLYWCH1 MISSION shRNA shRNA Plasmid DNA
FLYWCH-type zinc finger 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-788s1c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153791.1-2615s1c1
Sequence:CCGGCAGAACCTTTGCCTCTCATTTCTCGAGAAATGAGAGGCAAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-1085s1c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153791.1-1259s1c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1259s21c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-763s21c1
Sequence:CCGGCAAGAAGCAAGGACGGATAATCTCGAGATTATCCGTCCTTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153791.1-2643s21c1
Sequence:CCGGTCCCTTCCCATTGCCATGAAACTCGAGTTTCATGGCAATGGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-788s21c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1085s21c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153791
VALIDATED
FLYWCH1 MISSION shRNA Lentiviral Transduction Particles
FLYWCH-type zinc finger 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-788s1c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153791.1-2615s1c1
Sequence:CCGGCAGAACCTTTGCCTCTCATTTCTCGAGAAATGAGAGGCAAAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153791.1-1085s1c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153791.1-1259s1c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1259s21c1
Sequence:CCGGGAGTTCCTGAAGACTTGCTATCTCGAGATAGCAAGTCTTCAGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-763s21c1
Sequence:CCGGCAAGAAGCAAGGACGGATAATCTCGAGATTATCCGTCCTTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153791.1-2643s21c1
Sequence:CCGGTCCCTTCCCATTGCCATGAAACTCGAGTTTCATGGCAATGGGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-788s21c1
Sequence:CCGGCGGAAACGTAGTAGGGTAGATCTCGAGATCTACCCTACTACGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153791.1-1085s21c1
Sequence:CCGGGCTGAAGTCCAAGAAGATGAACTCGAGTTCATCTTCTTGGACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks