EMAIL THIS PAGE TO A FRIEND

FLYWCH2

FLYWCH family member 2

31 Gene Product Result for
UniProtKB ID: Q96CP2
Gene ID:
Mouse(76917) FLYWCH family member 2
Rat(100910745) FLYWCH family member 2
domestic cat(101099170) FLYWCH family member 2
cow(618572) FLYWCH family member 2
dog(479872) FLYWCH family member 2
naked mole-rat(101718423) FLYWCH family member 2
sheep(101116790) FLYWCH family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041354 Anti-FLYWCH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138439 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106161 MISSION® esiRNA esiRNA human FLYWCH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138439 Rosetta Predictions human pricing
NM_029798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223364 predicted 421
2 SASI_Hs01_00223365 predicted 369
3 SASI_Hs01_00223366 predicted 420
4 SASI_Hs01_00223367 predicted 421
5 SASI_Hs01_00223368 predicted 501
6 SASI_Hs01_00223369 predicted 274
7 SASI_Hs01_00223370 predicted 378
8 SASI_Hs01_00223363 predicted 378
9 SASI_Hs01_00223371 predicted 345
10 SASI_Hs02_00363599 predicted 709
11 SASI_Hs01_00223372 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134678 predicted 311
2 SASI_Mm01_00134679 predicted 439
3 SASI_Mm01_00134680 predicted 319
4 SASI_Mm01_00134681 predicted 297
5 SASI_Mm01_00134682 predicted 360
6 SASI_Mm02_00335942 predicted 355
7 SASI_Mm01_00134683 predicted 318
8 SASI_Mm01_00134684 predicted 448
9 SASI_Mm01_00134685 predicted 358
10 SASI_Mm01_00134686 predicted 201
11 SASI_Mm01_00134687 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029798
FLYWCH2 MISSION shRNA Bacterial Glycerol Stock
FLYWCH family member 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-285s21c1
Sequence:CCGGCAGGAAGCCCAGAAAGTTCTCCTCGAGGAGAACTTTCTGGGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-512s21c1
Sequence:CCGGCAGATGGTCCAGAAGACAATGCTCGAGCATTGTCTTCTGGACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-363s21c1
Sequence:CCGGCAAAGGAGTGCACTGCATCATCTCGAGATGATGCAGTGCACTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-417s21c1
Sequence:CCGGTAAGGCCCTCCTCAAGACTCACTCGAGTGAGTCTTGAGGAGGGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-315s21c1
Sequence:CCGGTCTGCTGACAGCCTCCAAAGACTCGAGTCTTTGGAGGCTGTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029798.1-300s1c1
Sequence:CCGGGTTCTCCAAACTGGTTCTGCTCTCGAGAGCAGAACCAGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029798
FLYWCH2 MISSION shRNA shRNA Plasmid DNA
FLYWCH family member 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-285s21c1
Sequence:CCGGCAGGAAGCCCAGAAAGTTCTCCTCGAGGAGAACTTTCTGGGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-512s21c1
Sequence:CCGGCAGATGGTCCAGAAGACAATGCTCGAGCATTGTCTTCTGGACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-363s21c1
Sequence:CCGGCAAAGGAGTGCACTGCATCATCTCGAGATGATGCAGTGCACTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-417s21c1
Sequence:CCGGTAAGGCCCTCCTCAAGACTCACTCGAGTGAGTCTTGAGGAGGGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-315s21c1
Sequence:CCGGTCTGCTGACAGCCTCCAAAGACTCGAGTCTTTGGAGGCTGTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029798.1-300s1c1
Sequence:CCGGGTTCTCCAAACTGGTTCTGCTCTCGAGAGCAGAACCAGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029798
FLYWCH2 MISSION shRNA Lentiviral Transduction Particles
FLYWCH family member 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-285s21c1
Sequence:CCGGCAGGAAGCCCAGAAAGTTCTCCTCGAGGAGAACTTTCTGGGCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-512s21c1
Sequence:CCGGCAGATGGTCCAGAAGACAATGCTCGAGCATTGTCTTCTGGACCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-363s21c1
Sequence:CCGGCAAAGGAGTGCACTGCATCATCTCGAGATGATGCAGTGCACTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-417s21c1
Sequence:CCGGTAAGGCCCTCCTCAAGACTCACTCGAGTGAGTCTTGAGGAGGGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029798.2-315s21c1
Sequence:CCGGTCTGCTGACAGCCTCCAAAGACTCGAGTCTTTGGAGGCTGTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029798.1-300s1c1
Sequence:CCGGGTTCTCCAAACTGGTTCTGCTCTCGAGAGCAGAACCAGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138439
FLYWCH2 MISSION shRNA Bacterial Glycerol Stock
FLYWCH family member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-512s21c1
Sequence:CCGGCTCCAAAGACAGCACCAAGGTCTCGAGACCTTGGTGCTGTCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-481s21c1
Sequence:CCGGGAAAGTTCTCCAAACTGGTCCCTCGAGGGACCAGTTTGGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138439.2-867s21c1
Sequence:CCGGGGCCAAATGGGTGAATCTTTGCTCGAGCAAAGATTCACCCATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-785s21c1
Sequence:CCGGGTCCCTGTAACCTTGACAACACTCGAGTGTTGTCAAGGTTACAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-702s21c1
Sequence:CCGGAGAACAGAAGACAGTGGATTACTCGAGTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-577s1c1
Sequence:CCGGGACAGAACAGAAGACAGTGGACTCGAGTCCACTGTCTTCTGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-581s1c1
Sequence:CCGGGAACAGAAGACAGTGGATTAGCTCGAGCTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-357s1c1
Sequence:CCGGCAGAAAGTTCTCCAAACTGGTCTCGAGACCAGTTTGGAGAACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138439
FLYWCH2 MISSION shRNA shRNA Plasmid DNA
FLYWCH family member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-512s21c1
Sequence:CCGGCTCCAAAGACAGCACCAAGGTCTCGAGACCTTGGTGCTGTCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-481s21c1
Sequence:CCGGGAAAGTTCTCCAAACTGGTCCCTCGAGGGACCAGTTTGGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138439.2-867s21c1
Sequence:CCGGGGCCAAATGGGTGAATCTTTGCTCGAGCAAAGATTCACCCATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-785s21c1
Sequence:CCGGGTCCCTGTAACCTTGACAACACTCGAGTGTTGTCAAGGTTACAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-702s21c1
Sequence:CCGGAGAACAGAAGACAGTGGATTACTCGAGTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-577s1c1
Sequence:CCGGGACAGAACAGAAGACAGTGGACTCGAGTCCACTGTCTTCTGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-581s1c1
Sequence:CCGGGAACAGAAGACAGTGGATTAGCTCGAGCTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-357s1c1
Sequence:CCGGCAGAAAGTTCTCCAAACTGGTCTCGAGACCAGTTTGGAGAACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138439
FLYWCH2 MISSION shRNA Lentiviral Transduction Particles
FLYWCH family member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-512s21c1
Sequence:CCGGCTCCAAAGACAGCACCAAGGTCTCGAGACCTTGGTGCTGTCTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-481s21c1
Sequence:CCGGGAAAGTTCTCCAAACTGGTCCCTCGAGGGACCAGTTTGGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138439.2-867s21c1
Sequence:CCGGGGCCAAATGGGTGAATCTTTGCTCGAGCAAAGATTCACCCATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-785s21c1
Sequence:CCGGGTCCCTGTAACCTTGACAACACTCGAGTGTTGTCAAGGTTACAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138439.2-702s21c1
Sequence:CCGGAGAACAGAAGACAGTGGATTACTCGAGTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-577s1c1
Sequence:CCGGGACAGAACAGAAGACAGTGGACTCGAGTCCACTGTCTTCTGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-581s1c1
Sequence:CCGGGAACAGAAGACAGTGGATTAGCTCGAGCTAATCCACTGTCTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138439.1-357s1c1
Sequence:CCGGCAGAAAGTTCTCCAAACTGGTCTCGAGACCAGTTTGGAGAACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks