EMAIL THIS PAGE TO A FRIEND

FMN1

formin 1

174 Gene Product Result for
Synonyms: FMN LD
UniProtKB ID: Q68DA7, Q3B7I6, Q3ZAR4, Q6ZSY1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001103184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001103184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001103184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103184 Rosetta Predictions human pricing
XM_375185 Rosetta Predictions human pricing
XM_931354 Rosetta Predictions human pricing
XM_931363 Rosetta Predictions human pricing
XM_001080558 Rosetta Predictions rat pricing
XM_231006 Rosetta Predictions rat pricing
NM_001043322 Rosetta Predictions mouse pricing
NM_010230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323673 predicted 2503
2 SASI_Hs02_00323674 predicted 3149
3 SASI_Hs02_00323675 predicted 364
4 SASI_Hs02_00323676 predicted 2810
5 SASI_Hs02_00323677 predicted 3015
6 SASI_Hs02_00323678 predicted 1321
7 SASI_Hs02_00323679 predicted 3280
8 SASI_Hs02_00323680 predicted 2332
9 SASI_Hs02_00323681 predicted 3402
10 SASI_Hs02_00323682 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275226 predicted 525
2 SASI_Hs01_00275227 predicted 1269
3 SASI_Hs01_00275228 predicted 396
4 SASI_Hs01_00275229 predicted 517
5 SASI_Hs01_00275230 predicted 498
6 SASI_Hs01_00275231 predicted 1361
7 SASI_Hs01_00275232 predicted 385
8 SASI_Hs01_00275233 predicted 358
9 SASI_Hs01_00275234 predicted 1315
10 SASI_Hs01_00275235 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258709 predicted 1439
2 SASI_Hs01_00258710 predicted 1448
3 SASI_Hs01_00258711 predicted 2103
4 SASI_Hs01_00258712 predicted 1761
5 SASI_Hs01_00258713 predicted 1962
6 SASI_Hs01_00258714 predicted 266
7 SASI_Hs01_00258715 predicted 2235
8 SASI_Hs01_00258716 predicted 1286
9 SASI_Hs01_00258717 predicted 2358
10 SASI_Hs01_00258718 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254727 predicted 453
2 SASI_Hs01_00254728 predicted 274
3 SASI_Hs01_00254729 predicted 275
4 SASI_Hs01_00254730 predicted 339
5 SASI_Hs01_00254731 predicted 351
6 SASI_Hs01_00254732 predicted 316
7 SASI_Hs01_00254733 predicted 465
8 SASI_Hs01_00254734 predicted 318
9 SASI_Hs01_00254735 predicted 348
10 SASI_Hs01_00254736 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368432 predicted 1164
2 SASI_Rn02_00368433 predicted 405
3 SASI_Rn02_00368434 predicted 1056
4 SASI_Rn02_00368435 predicted 1049
5 SASI_Rn02_00368436 predicted 280
6 SASI_Rn02_00368437 predicted 243
7 SASI_Rn02_00368438 predicted 426
8 SASI_Rn02_00368439 predicted 284
9 SASI_Rn02_00368440 predicted 308
10 SASI_Rn02_00368441 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386632 predicted 1211
2 SASI_Rn02_00386633 predicted 1317
3 SASI_Rn02_00386634 predicted 2755
4 SASI_Rn02_00386635 predicted 809
5 SASI_Rn02_00386636 predicted 2801
6 SASI_Rn02_00386637 predicted 366
7 SASI_Rn02_00386638 predicted 2747
8 SASI_Rn02_00386639 predicted 1033
9 SASI_Rn02_00386640 predicted 2739
10 SASI_Rn02_00386641 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291165 predicted 1423
2 SASI_Mm02_00291166 predicted 3416
3 SASI_Mm02_00291167 predicted 2234
4 SASI_Mm02_00291168 predicted 3435
5 SASI_Mm02_00291169 predicted 3426
6 SASI_Mm02_00291170 predicted 2504
7 SASI_Mm02_00291171 predicted 2416
8 SASI_Mm02_00291172 predicted 835
9 SASI_Mm02_00291173 predicted 525
10 SASI_Mm02_00291174 predicted 4204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081330 predicted 1422
2 SASI_Mm01_00081331 predicted 3417
3 SASI_Mm01_00081332 predicted 2227
4 SASI_Mm01_00081333 predicted 3429
5 SASI_Mm01_00081334 predicted 3425
6 SASI_Mm02_00318087 predicted 2499
7 SASI_Mm01_00081335 predicted 2412
8 SASI_Mm01_00081336 predicted 837
9 SASI_Mm01_00081337 predicted 527
10 SASI_Mm02_00318088 predicted 4310
11 SASI_Mm01_00081338 predicted 3879
12 SASI_Mm01_00081339 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010230
VALIDATED
FMN1 MISSION shRNA Bacterial Glycerol Stock
formin 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-3372s1c1
Sequence:CCGGGCGATCTCAAACTGTGGGAATCTCGAGATTCCCACAGTTTGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010230.1-2397s1c1
Sequence:CCGGGCAGGCTCAGTTTGAACTCAACTCGAGTTGAGTTCAAACTGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010230.1-4748s1c1
Sequence:CCGGCCACAAGAACAATGCAAAGTTCTCGAGAACTTTGCATTGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-1045s1c1
Sequence:CCGGCCACAACCAAATGTGTCTGAACTCGAGTTCAGACACATTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-4520s1c1
Sequence:CCGGCCACCGCTAGTCTGAAAGAAACTCGAGTTTCTTTCAGACTAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1716s21c1
Sequence:CCGGCAGCTCTTGGCATGGTATTTACTCGAGTAAATACCATGCCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3844s21c1
Sequence:CCGGAGGGCAAGCAGACGGATATAGCTCGAGCTATATCCGTCTGCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1608s21c1
Sequence:CCGGTACCGCAGAGTGGCCATAAATCTCGAGATTTATGGCCACTCTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010230.2-5042s21c1
Sequence:CCGGCTGTTATACTGAGATCCTATTCTCGAGAATAGGATCTCAGTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3464s21c1
Sequence:CCGGGATATTCAACAGGCCATATTTCTCGAGAAATATGGCCTGTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3239s21c1
Sequence:CCGGCAAGACGCCGCACCAACTTTACTCGAGTAAAGTTGGTGCGGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-417s21c1
Sequence:CCGGACGAACATCCAGGCGACATATCTCGAGATATGTCGCCTGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3267s21c1
Sequence:CCGGCCTTAGAAGAGCCTCATATTACTCGAGTAATATGAGGCTCTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010230
VALIDATED
FMN1 MISSION shRNA shRNA Plasmid DNA
formin 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-3372s1c1
Sequence:CCGGGCGATCTCAAACTGTGGGAATCTCGAGATTCCCACAGTTTGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010230.1-2397s1c1
Sequence:CCGGGCAGGCTCAGTTTGAACTCAACTCGAGTTGAGTTCAAACTGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010230.1-4748s1c1
Sequence:CCGGCCACAAGAACAATGCAAAGTTCTCGAGAACTTTGCATTGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-1045s1c1
Sequence:CCGGCCACAACCAAATGTGTCTGAACTCGAGTTCAGACACATTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-4520s1c1
Sequence:CCGGCCACCGCTAGTCTGAAAGAAACTCGAGTTTCTTTCAGACTAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1716s21c1
Sequence:CCGGCAGCTCTTGGCATGGTATTTACTCGAGTAAATACCATGCCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3844s21c1
Sequence:CCGGAGGGCAAGCAGACGGATATAGCTCGAGCTATATCCGTCTGCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1608s21c1
Sequence:CCGGTACCGCAGAGTGGCCATAAATCTCGAGATTTATGGCCACTCTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010230.2-5042s21c1
Sequence:CCGGCTGTTATACTGAGATCCTATTCTCGAGAATAGGATCTCAGTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3464s21c1
Sequence:CCGGGATATTCAACAGGCCATATTTCTCGAGAAATATGGCCTGTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3239s21c1
Sequence:CCGGCAAGACGCCGCACCAACTTTACTCGAGTAAAGTTGGTGCGGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-417s21c1
Sequence:CCGGACGAACATCCAGGCGACATATCTCGAGATATGTCGCCTGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3267s21c1
Sequence:CCGGCCTTAGAAGAGCCTCATATTACTCGAGTAATATGAGGCTCTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010230
VALIDATED
FMN1 MISSION shRNA Lentiviral Transduction Particles
formin 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-3372s1c1
Sequence:CCGGGCGATCTCAAACTGTGGGAATCTCGAGATTCCCACAGTTTGAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010230.1-2397s1c1
Sequence:CCGGGCAGGCTCAGTTTGAACTCAACTCGAGTTGAGTTCAAACTGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010230.1-4748s1c1
Sequence:CCGGCCACAAGAACAATGCAAAGTTCTCGAGAACTTTGCATTGTTCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-1045s1c1
Sequence:CCGGCCACAACCAAATGTGTCTGAACTCGAGTTCAGACACATTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010230.1-4520s1c1
Sequence:CCGGCCACCGCTAGTCTGAAAGAAACTCGAGTTTCTTTCAGACTAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1716s21c1
Sequence:CCGGCAGCTCTTGGCATGGTATTTACTCGAGTAAATACCATGCCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3844s21c1
Sequence:CCGGAGGGCAAGCAGACGGATATAGCTCGAGCTATATCCGTCTGCTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-1608s21c1
Sequence:CCGGTACCGCAGAGTGGCCATAAATCTCGAGATTTATGGCCACTCTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010230.2-5042s21c1
Sequence:CCGGCTGTTATACTGAGATCCTATTCTCGAGAATAGGATCTCAGTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3464s21c1
Sequence:CCGGGATATTCAACAGGCCATATTTCTCGAGAAATATGGCCTGTTGAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3239s21c1
Sequence:CCGGCAAGACGCCGCACCAACTTTACTCGAGTAAAGTTGGTGCGGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-417s21c1
Sequence:CCGGACGAACATCCAGGCGACATATCTCGAGATATGTCGCCTGGATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010230.2-3267s21c1
Sequence:CCGGCCTTAGAAGAGCCTCATATTACTCGAGTAATATGAGGCTCTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103184
FMN1 MISSION shRNA Bacterial Glycerol Stock
formin 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2374s21c1
Sequence:CCGGCCCAGTGAATTTGAGTATTTACTCGAGTAAATACTCAAATTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-3000s21c1
Sequence:CCGGTCTGGTGGACTACGTTGTTAACTCGAGTTAACAACGTAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2509s21c1
Sequence:CCGGGGAATCTTGATATCTAGTTTACTCGAGTAAACTAGATATCAAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2286s21c1
Sequence:CCGGATATTGGACTAGGATACAAATCTCGAGATTTGTATCCTAGTCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103184
FMN1 MISSION shRNA shRNA Plasmid DNA
formin 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2374s21c1
Sequence:CCGGCCCAGTGAATTTGAGTATTTACTCGAGTAAATACTCAAATTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-3000s21c1
Sequence:CCGGTCTGGTGGACTACGTTGTTAACTCGAGTTAACAACGTAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2509s21c1
Sequence:CCGGGGAATCTTGATATCTAGTTTACTCGAGTAAACTAGATATCAAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2286s21c1
Sequence:CCGGATATTGGACTAGGATACAAATCTCGAGATTTGTATCCTAGTCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103184
FMN1 MISSION shRNA Lentiviral Transduction Particles
formin 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2374s21c1
Sequence:CCGGCCCAGTGAATTTGAGTATTTACTCGAGTAAATACTCAAATTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-3000s21c1
Sequence:CCGGTCTGGTGGACTACGTTGTTAACTCGAGTTAACAACGTAGTCCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2509s21c1
Sequence:CCGGGGAATCTTGATATCTAGTTTACTCGAGTAAACTAGATATCAAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103184.1-2286s21c1
Sequence:CCGGATATTGGACTAGGATACAAATCTCGAGATTTGTATCCTAGTCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks