EMAIL THIS PAGE TO A FRIEND

FMN2

formin 2

141 Gene Product Result for
UniProtKB ID: Q9NZ56, B0QZA7, Q59GF6, Q5VU37, Q9NZ55
Gene ID:
Human(56776) Summary: Formin homology (FH) domain proteins (see FMN1; MIM 136535) play a role in cytoskeletal organization and/or establishment of cell polarity.[supplied by OMIM, Apr 2010]
Mouse(54418) formin 2
Rat(289262) formin 2
chicken(775973) formin 2
dog(490366) formin 2
Horse(100060203) formin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020066 Rosetta Predictions human pricing
XM_001058601 Rosetta Predictions rat pricing
XM_222920 Rosetta Predictions rat pricing
NM_019445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068455 predicted 4078
2 SASI_Hs02_00352952 predicted 4192
3 SASI_Hs01_00068457 predicted 4273
4 SASI_Hs01_00068458 predicted 1908
5 SASI_Hs01_00068460 predicted 4257
6 SASI_Hs01_00068461 predicted 1979
7 SASI_Hs01_00068463 predicted 2415
8 SASI_Hs02_00352953 predicted 4764
9 SASI_Hs01_00068464 predicted 4283
10 SASI_Hs02_00352954 predicted 1961
11 SASI_Hs01_00068456 predicted 4582
12 SASI_Hs01_00068459 predicted 4742
13 SASI_Hs01_00068462 predicted 4729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290284 predicted 3736
2 SASI_Rn02_00290285 predicted 3931
3 SASI_Rn02_00290286 predicted 4221
4 SASI_Rn02_00290287 predicted 2032
5 SASI_Rn02_00290288 predicted 2424
6 SASI_Rn02_00290289 predicted 4547
7 SASI_Rn02_00290290 predicted 3566
8 SASI_Rn02_00290291 predicted 1964
9 SASI_Rn02_00290292 predicted 2319
10 SASI_Rn02_00290293 predicted 3471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184228 predicted 3524
2 SASI_Rn01_00184229 predicted 3395
3 SASI_Rn01_00184230 predicted 3717
4 SASI_Rn01_00184231 predicted 4015
5 SASI_Rn01_00184232 predicted 3184
6 SASI_Rn01_00184233 predicted 3393
7 SASI_Rn01_00184234 predicted 4334
8 SASI_Rn01_00184235 predicted 3077
9 SASI_Rn01_00184236 predicted 3993
10 SASI_Rn01_00184237 predicted 3515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145617 predicted 2079
2 SASI_Mm01_00145618 predicted 3842
3 SASI_Mm01_00145619 predicted 3738
4 SASI_Mm01_00145620 predicted 4097
5 SASI_Mm01_00145621 predicted 4401
6 SASI_Mm02_00324422 predicted 4184
7 SASI_Mm02_00324423 predicted 3886
8 SASI_Mm02_00324424 predicted 2068
9 SASI_Mm02_00324425 predicted 3657
10 SASI_Mm02_00324426 predicted 3527
11 SASI_Mm01_00145616 predicted 4748
12 SASI_Mm01_00145622 predicted 4874
13 SASI_Mm01_00145623 predicted 4161
14 SASI_Mm01_00145624 predicted 3863
15 SASI_Mm01_00145625 predicted 1843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019445
FMN2 MISSION shRNA Bacterial Glycerol Stock
formin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-1881s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-4069s21c1
Sequence:CCGGACGCCAAGTCTCTCGACAAACCTCGAGGTTTGTCGAGAGACTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-2060s21c1
Sequence:CCGGCAGTCCCAAGGACGTTGATACCTCGAGGTATCAACGTCCTTGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-533s21c1
Sequence:CCGGGGACAGCGCTCACTCTATAGTCTCGAGACTATAGAGTGAGCGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2218s1c1
Sequence:CCGGGCTGAGCTAGAGAAGCAATATCTCGAGATATTGCTTCTCTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-4639s1c1
Sequence:CCGGGCCCTGACAGAGACTCATAAACTCGAGTTTATGAGTCTCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2857s1c1
Sequence:CCGGGCCCTACAATTTAGCAATCTACTCGAGTAGATTGCTAAATTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-3633s1c1
Sequence:CCGGGCCTCTCTATTGGACAAGAATCTCGAGATTCTTGTCCAATAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019445.1-5233s1c1
Sequence:CCGGGCCTATGGTTTCTCTCTTGTTCTCGAGAACAAGAGAGAAACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019445
FMN2 MISSION shRNA shRNA Plasmid DNA
formin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-1881s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-4069s21c1
Sequence:CCGGACGCCAAGTCTCTCGACAAACCTCGAGGTTTGTCGAGAGACTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-2060s21c1
Sequence:CCGGCAGTCCCAAGGACGTTGATACCTCGAGGTATCAACGTCCTTGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-533s21c1
Sequence:CCGGGGACAGCGCTCACTCTATAGTCTCGAGACTATAGAGTGAGCGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2218s1c1
Sequence:CCGGGCTGAGCTAGAGAAGCAATATCTCGAGATATTGCTTCTCTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-4639s1c1
Sequence:CCGGGCCCTGACAGAGACTCATAAACTCGAGTTTATGAGTCTCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2857s1c1
Sequence:CCGGGCCCTACAATTTAGCAATCTACTCGAGTAGATTGCTAAATTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-3633s1c1
Sequence:CCGGGCCTCTCTATTGGACAAGAATCTCGAGATTCTTGTCCAATAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019445.1-5233s1c1
Sequence:CCGGGCCTATGGTTTCTCTCTTGTTCTCGAGAACAAGAGAGAAACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019445
FMN2 MISSION shRNA Lentiviral Transduction Particles
formin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-1881s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-4069s21c1
Sequence:CCGGACGCCAAGTCTCTCGACAAACCTCGAGGTTTGTCGAGAGACTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-2060s21c1
Sequence:CCGGCAGTCCCAAGGACGTTGATACCTCGAGGTATCAACGTCCTTGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019445.2-533s21c1
Sequence:CCGGGGACAGCGCTCACTCTATAGTCTCGAGACTATAGAGTGAGCGCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2218s1c1
Sequence:CCGGGCTGAGCTAGAGAAGCAATATCTCGAGATATTGCTTCTCTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-4639s1c1
Sequence:CCGGGCCCTGACAGAGACTCATAAACTCGAGTTTATGAGTCTCTGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-2857s1c1
Sequence:CCGGGCCCTACAATTTAGCAATCTACTCGAGTAGATTGCTAAATTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019445.1-3633s1c1
Sequence:CCGGGCCTCTCTATTGGACAAGAATCTCGAGATTCTTGTCCAATAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019445.1-5233s1c1
Sequence:CCGGGCCTATGGTTTCTCTCTTGTTCTCGAGAACAAGAGAGAAACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020066
VALIDATED
FMN2 MISSION shRNA Bacterial Glycerol Stock
formin 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-4379s21c1
Sequence:CCGGCTGTTGTGAACTTGGATAATTCTCGAGAATTATCCAAGTTCACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-4842s21c1
Sequence:CCGGTTCGTATTATCTCCGAAATTTCTCGAGAAATTTCGGAGATAATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-2588s21c1
Sequence:CCGGTTGTGTCTCCAAGGCGAATATCTCGAGATATTCGCCTTGGAGACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5417s21c1
Sequence:CCGGTGAGTCATTGCAACGACTTTCCTCGAGGAAAGTCGTTGCAATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-1954s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-5139s21c1
Sequence:CCGGTTTGGAGACCACGGCATATTTCTCGAGAAATATGCCGTGGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5824s21c1
Sequence:CCGGTGAATTGTTTGTATCAGTTTCCTCGAGGAAACTGATACAAACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-758s21c1
Sequence:CCGGGCTCGGACACGGACATCTATACTCGAGTATAGATGTCCGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020066.3-6122s1c1
Sequence:CCGGGCTCTCCATAACTATGTATTTCTCGAGAAATACATAGTTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4486s1c1
Sequence:CCGGGCTAAACAAGTTGTCAAGTTACTCGAGTAACTTGACAACTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-2919s1c1
Sequence:CCGGCCATTCTATTTCTACCGAGTTCTCGAGAACTCGGTAGAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4325s1c1
Sequence:CCGGCCAGGATTCAACTACATAGTACTCGAGTACTATGTAGTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-34s1c1
Sequence:CCGGCCCGAGATAGAGGAAACGTTTCTCGAGAAACGTTTCCTCTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020066
VALIDATED
FMN2 MISSION shRNA shRNA Plasmid DNA
formin 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-4379s21c1
Sequence:CCGGCTGTTGTGAACTTGGATAATTCTCGAGAATTATCCAAGTTCACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-4842s21c1
Sequence:CCGGTTCGTATTATCTCCGAAATTTCTCGAGAAATTTCGGAGATAATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-2588s21c1
Sequence:CCGGTTGTGTCTCCAAGGCGAATATCTCGAGATATTCGCCTTGGAGACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5417s21c1
Sequence:CCGGTGAGTCATTGCAACGACTTTCCTCGAGGAAAGTCGTTGCAATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-1954s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-5139s21c1
Sequence:CCGGTTTGGAGACCACGGCATATTTCTCGAGAAATATGCCGTGGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5824s21c1
Sequence:CCGGTGAATTGTTTGTATCAGTTTCCTCGAGGAAACTGATACAAACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-758s21c1
Sequence:CCGGGCTCGGACACGGACATCTATACTCGAGTATAGATGTCCGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020066.3-6122s1c1
Sequence:CCGGGCTCTCCATAACTATGTATTTCTCGAGAAATACATAGTTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4486s1c1
Sequence:CCGGGCTAAACAAGTTGTCAAGTTACTCGAGTAACTTGACAACTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-2919s1c1
Sequence:CCGGCCATTCTATTTCTACCGAGTTCTCGAGAACTCGGTAGAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4325s1c1
Sequence:CCGGCCAGGATTCAACTACATAGTACTCGAGTACTATGTAGTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-34s1c1
Sequence:CCGGCCCGAGATAGAGGAAACGTTTCTCGAGAAACGTTTCCTCTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020066
VALIDATED
FMN2 MISSION shRNA Lentiviral Transduction Particles
formin 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-4379s21c1
Sequence:CCGGCTGTTGTGAACTTGGATAATTCTCGAGAATTATCCAAGTTCACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-4842s21c1
Sequence:CCGGTTCGTATTATCTCCGAAATTTCTCGAGAAATTTCGGAGATAATACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-2588s21c1
Sequence:CCGGTTGTGTCTCCAAGGCGAATATCTCGAGATATTCGCCTTGGAGACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5417s21c1
Sequence:CCGGTGAGTCATTGCAACGACTTTCCTCGAGGAAAGTCGTTGCAATGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-1954s21c1
Sequence:CCGGTGCTTCAGGGAACCGTGTAATCTCGAGATTACACGGTTCCCTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020066.4-5139s21c1
Sequence:CCGGTTTGGAGACCACGGCATATTTCTCGAGAAATATGCCGTGGTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020066.4-5824s21c1
Sequence:CCGGTGAATTGTTTGTATCAGTTTCCTCGAGGAAACTGATACAAACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020066.4-758s21c1
Sequence:CCGGGCTCGGACACGGACATCTATACTCGAGTATAGATGTCCGTGTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020066.3-6122s1c1
Sequence:CCGGGCTCTCCATAACTATGTATTTCTCGAGAAATACATAGTTATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4486s1c1
Sequence:CCGGGCTAAACAAGTTGTCAAGTTACTCGAGTAACTTGACAACTTGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-2919s1c1
Sequence:CCGGCCATTCTATTTCTACCGAGTTCTCGAGAACTCGGTAGAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-4325s1c1
Sequence:CCGGCCAGGATTCAACTACATAGTACTCGAGTACTATGTAGTTGAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020066.3-34s1c1
Sequence:CCGGCCCGAGATAGAGGAAACGTTTCTCGAGAAACGTTTCCTCTATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks