EMAIL THIS PAGE TO A FRIEND

FMNL1

formin-like 1

90 Gene Product Result for
Synonyms: C17orf1 C17orf1B FHOD4 FMNL KW-13
Gene ID:
Human(752) Summary: This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(57778) formin-like 1
Rat(287746) formin-like 1
chicken(419965) formin-like 1
cow(788992) formin-like 1
Horse(100064045) formin-like 1
domestic cat(101087023) formin-like 1
dog(490927) formin-like 1
sheep(101119232) formin-like 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005892 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149301 MISSION® esiRNA esiRNA human FMNL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005892 siRNAs that have been validated in the lab human pricing
NM_001105846 Rosetta Predictions rat pricing
NM_001077698 Rosetta Predictions mouse pricing
NM_019679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005892 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192709 validated 950
2 SASI_Hs01_00192708 predicted 3392
3 SASI_Hs01_00192710 predicted 1295
4 SASI_Hs02_00340491 predicted 460
5 SASI_Hs01_00192711 predicted 2984
6 SASI_Hs01_00192713 predicted 2469
7 SASI_Hs01_00192714 predicted 1373
8 SASI_Hs01_00192715 predicted 1066
9 SASI_Hs01_00192716 predicted 2868
10 SASI_Hs01_00192717 predicted 2518
11 SASI_Hs01_00192712 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213102 predicted 2752
2 SASI_Rn02_00213103 predicted 408
3 SASI_Rn02_00213104 predicted 1077
4 SASI_Rn02_00213105 predicted 2175
5 SASI_Rn02_00213106 predicted 2425
6 SASI_Rn02_00213107 predicted 449
7 SASI_Rn02_00213108 predicted 1877
8 SASI_Rn02_00213109 predicted 3101
9 SASI_Rn02_00213110 predicted 1343
10 SASI_Rn02_00213111 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292912 predicted 2622
2 SASI_Mm02_00292913 predicted 943
3 SASI_Mm02_00292914 predicted 2942
4 SASI_Mm02_00292915 predicted 473
5 SASI_Mm02_00292916 predicted 2329
6 SASI_Mm02_00292917 predicted 1100
7 SASI_Mm02_00292918 predicted 2271
8 SASI_Mm02_00292919 predicted 937
9 SASI_Mm02_00292920 predicted 351
10 SASI_Mm02_00292921 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041024 predicted 2621
2 SASI_Mm01_00041025 predicted 942
3 SASI_Mm01_00041026 predicted 2948
4 SASI_Mm01_00041027 predicted 470
5 SASI_Mm01_00041028 predicted 2326
6 SASI_Mm01_00041029 predicted 1101
7 SASI_Mm01_00041030 predicted 2271
8 SASI_Mm01_00041032 predicted 936
9 SASI_Mm02_00324756 predicted 355
10 SASI_Mm01_00041033 predicted 1533
11 SASI_Mm01_00041031 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019679
FMNL1 MISSION shRNA Bacterial Glycerol Stock
formin-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-687s1c1
Sequence:CCGGGATCGCTCTAAGCCTTAACAACTCGAGTTGTTAAGGCTTAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-2418s1c1
Sequence:CCGGCCTAGAGATTGTCCTGGCTTTCTCGAGAAAGCCAGGACAATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-212s1c1
Sequence:CCGGGCCGAAAGGTAGCATCTGATTCTCGAGAATCAGATGCTACCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-1940s1c1
Sequence:CCGGAGGAACACTTTAAGACCAAATCTCGAGATTTGGTCTTAAAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019679
FMNL1 MISSION shRNA shRNA Plasmid DNA
formin-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-687s1c1
Sequence:CCGGGATCGCTCTAAGCCTTAACAACTCGAGTTGTTAAGGCTTAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-2418s1c1
Sequence:CCGGCCTAGAGATTGTCCTGGCTTTCTCGAGAAAGCCAGGACAATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-212s1c1
Sequence:CCGGGCCGAAAGGTAGCATCTGATTCTCGAGAATCAGATGCTACCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-1940s1c1
Sequence:CCGGAGGAACACTTTAAGACCAAATCTCGAGATTTGGTCTTAAAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019679
FMNL1 MISSION shRNA Lentiviral Transduction Particles
formin-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-687s1c1
Sequence:CCGGGATCGCTCTAAGCCTTAACAACTCGAGTTGTTAAGGCTTAGAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-2418s1c1
Sequence:CCGGCCTAGAGATTGTCCTGGCTTTCTCGAGAAAGCCAGGACAATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-212s1c1
Sequence:CCGGGCCGAAAGGTAGCATCTGATTCTCGAGAATCAGATGCTACCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019679.1-1940s1c1
Sequence:CCGGAGGAACACTTTAAGACCAAATCTCGAGATTTGGTCTTAAAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005892
VALIDATED
FMNL1 MISSION shRNA Bacterial Glycerol Stock
formin-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3616s1c1
Sequence:CCGGCCGCTATTTCTGCAGGTGGATCTCGAGATCCACCTGCAGAAATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-2104s1c1
Sequence:CCGGCCATCCAGACTAAGTTCCGAACTCGAGTTCGGAACTTAGTCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3163s1c1
Sequence:CCGGCCCTCTTTAGCCGCTTCATTACTCGAGTAATGAAGCGGCTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-414s1c1
Sequence:CCGGGAGCGGTTTCAAGTCAAGAATCTCGAGATTCTTGACTTGAAACCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005892.3-882s1c1
Sequence:CCGGCACGTCTGTATTATGTGCCTACTCGAGTAGGCACATAATACAGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-491s21c1
Sequence:CCGGCCGAAAGGTAGCAGCTGATTGCTCGAGCAATCAGCTGCTACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-1324s21c1
Sequence:CCGGAGGCGTACCTGGACAATATTTCTCGAGAAATATTGTCCAGGTACGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005892
VALIDATED
FMNL1 MISSION shRNA shRNA Plasmid DNA
formin-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3616s1c1
Sequence:CCGGCCGCTATTTCTGCAGGTGGATCTCGAGATCCACCTGCAGAAATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-2104s1c1
Sequence:CCGGCCATCCAGACTAAGTTCCGAACTCGAGTTCGGAACTTAGTCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3163s1c1
Sequence:CCGGCCCTCTTTAGCCGCTTCATTACTCGAGTAATGAAGCGGCTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-414s1c1
Sequence:CCGGGAGCGGTTTCAAGTCAAGAATCTCGAGATTCTTGACTTGAAACCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005892.3-882s1c1
Sequence:CCGGCACGTCTGTATTATGTGCCTACTCGAGTAGGCACATAATACAGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-491s21c1
Sequence:CCGGCCGAAAGGTAGCAGCTGATTGCTCGAGCAATCAGCTGCTACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-1324s21c1
Sequence:CCGGAGGCGTACCTGGACAATATTTCTCGAGAAATATTGTCCAGGTACGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005892
VALIDATED
FMNL1 MISSION shRNA Lentiviral Transduction Particles
formin-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3616s1c1
Sequence:CCGGCCGCTATTTCTGCAGGTGGATCTCGAGATCCACCTGCAGAAATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-2104s1c1
Sequence:CCGGCCATCCAGACTAAGTTCCGAACTCGAGTTCGGAACTTAGTCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-3163s1c1
Sequence:CCGGCCCTCTTTAGCCGCTTCATTACTCGAGTAATGAAGCGGCTAAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005892.3-414s1c1
Sequence:CCGGGAGCGGTTTCAAGTCAAGAATCTCGAGATTCTTGACTTGAAACCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005892.3-882s1c1
Sequence:CCGGCACGTCTGTATTATGTGCCTACTCGAGTAGGCACATAATACAGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-491s21c1
Sequence:CCGGCCGAAAGGTAGCAGCTGATTGCTCGAGCAATCAGCTGCTACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005892.3-1324s21c1
Sequence:CCGGAGGCGTACCTGGACAATATTTCTCGAGAAATATTGTCCAGGTACGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks